Taxonomic Update for obitools4

tools/obitools/macros.xml

@@ -44,6 +44,75 @@
             #end if
     ]]></token>
 
+    <xml name="taxo_macro_optional">
+        <conditional name="taxo_condi">
+            <param name="taxonomic_select" type="select" display="radio" label="Do you want to use a taxonomic database ?">
+                <option value="no_taxo">No Taxonomic Database</option>
+                <option value="use_taxo">Use taxonomic Database</option>
+            </param>
+            <when value="no_taxo"></when>
+            <when value="use_taxo">
+                <conditional name="taxonomy">
+                    <param name="taxonomy_source" type="select" label="Choose source of NCBI Taxonomy">
+                        <option value="cached" selected="true">Use built-in NCBI Taxonomy database</option>
+                        <option value="history">Datasets from history</option>
+                    </param>
+                        <when value="cached">
+                            <param type="select" name="taxonomy_table" label="NCBI Taxonomy database">
+                                <options from_data_table="ncbi_taxonomy">
+                                    <filter type="sort_by" column="name"/>
+                                    <validator type="no_options" message="No NCBI Taxonomy downloads are available"/>
+                                </options>
+                                <validator type="no_options" message="No NCBI Taxonomy database download is available"/>
+                            </param>
+                        </when>
+                        <when value="history">
+                            <param name="taxdump" type="data" format="tar,tar.gz,tgz,csv" label="NCBI Taxonomic database"/>
+                        </when>
+                </conditional>
+            </when>
+        </conditional>
+    </xml>
+
+    <xml name="taxo_macro">
+        <conditional name="taxonomy">
+            <param name="taxonomy_source" type="select" label="Choose source of NCBI Taxonomy">
+                <option value="cached" selected="true">Use built-in NCBI Taxonomy database</option>
+                <option value="history">Datasets from history</option>
+            </param>
+            <when value="cached">
+                <param type="select" name="taxonomy_table" label="NCBI Taxonomy database">
+                    <options from_data_table="ncbi_taxonomy">
+                        <filter type="sort_by" column="name"/>
+                        <validator type="no_options" message="No NCBI Taxonomy downloads are available"/>
+                    </options>
+                    <validator type="no_options" message="No NCBI Taxonomy database download is available"/>
+                </param>
+            </when>
+            <when value="history">
+                <param name="taxdump" type="data" format="tar,tar.gz,tgz,csv" label="NCBI Taxonomic database"/>
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@TAXO_DIR@"><![CDATA[
+        #if str($taxonomy.taxonomy_source) == 'cached':
+            --taxonomy '$taxonomy.taxonomy_table.fields.path'
+        #else
+            --taxonomy '$taxonomy.taxdump'
+        #end if
+    ]]></token>
+
+    <token name="@TAXO_DIR_OPTIONAL@"><![CDATA[
+        #if str($taxo_condi.taxonomic_select) == 'use_taxo':
+            #if str($taxo_condi.taxonomy.taxonomy_source) == 'cached':
+                --taxonomy '$taxonomy.taxonomy_table.fields.path'
+            #else
+                --taxonomy '$taxo_condi.taxonomy.taxdump'
+            #end if
+        #end if
+    ]]></token>
+
     <token name="@OUT_FORMAT@"><![CDATA[
         #if str($out_format) in ["fasta.gz", "fastq.gz"] or ($input.ext.endswith(".gz") and str($out_format) not in ["fasta", "fastq"])
             --compress
@@ -77,6 +146,35 @@
         <param name="compress_bool" type="boolean" truevalue="--compress" falsevalue="" checked="false" label="Do you want to compress the output file ?"/>
     </xml>
 
+        <xml name="macro_restrict_rank">
+        <param name="rank" type="select" label="Restrict to the given taxonomic rank" multiple="true" optional="true">
+            <option value="species">species</option>
+            <option value="genus">genus</option>
+            <option value="family">family</option>
+            <option value="class">class</option>
+            <option value="order">order</option>
+            <option value="phylum">phylum</option>
+            <option value="kingdom">kingdom</option>
+            <option value="domain">domain</option>
+        </param>
+    </xml>
+
+    <token name="@RESTRICT_TO_RANK@"><![CDATA[
+        #for i in $rank
+            --require-rank $i
+        #end for
+    ]]></token>
+
+    <xml name="macro_restrict_taxon">
+        <param name="taxon" type="integer" label="Restrict to a specific taxon by his taxid" help="Require that the actual taxon of the sequence belongs the provided taxid." optional="true"/>
+    </xml>
+
+    <token name="@RESTRICT_TO_TAXON@"><![CDATA[
+        #if $taxon
+            --restrict-to-taxon $taxon
+        #end if
+    ]]></token>
+
     <token name="@OBITOOLS_LINK_OBI4@">
 <![CDATA[
 --------

tools/obitools/obicomplement.xml

@@ -0,0 +1,48 @@
+<tool id="obi_complement" name="obicomplement" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>
+        Compute the reverse complement of the sequence entries.
+    </description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
+    <command><![CDATA[
+        obicomplement
+        --no-progressbar
+        @INPUT_FORMAT@
+        @OUT_FORMAT@
+        $input
+        > $output
+    ]]></command>
+    <inputs>
+        <param name="input" type="data" format="@INPUT_FORMATS@"/>
+        <expand macro="input_format_options_macro"/>
+        <expand macro="out_format_macro"/>
+    </inputs>
+    <outputs>
+        <data name="output" format_source="input">
+            <expand macro="change_format_macro"/>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="output_obipairing.fastqsanger" ftype="fastqsanger"/>
+            <output name="output" value="output_obicomplement.fastqsanger" ftype="fastqsanger"/>
+        </test>
+    </tests>
+    <help>
+        .. class:: infomark
+
+**What it does**
+
+Compute the reverse complement of the sequence entries.
+
+@OBITOOLS4_IMAGE@
+
+@OBITOOLS_LINK_OBI4@
+
+    </help>
+    <expand macro="citation" />
+
+</tool>

tools/obitools/obipcr.xml

@@ -0,0 +1,90 @@
+<tool id="obi_pcr" name="obipcr" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>
+        In sillico PCR
+    </description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
+    <command><![CDATA[
+        obipcr
+        --no-progressbar
+        --forward $forward
+        --reverse $reverse
+        --max-length $max_length
+        -e $allowed_mismatches
+        #if $min_length
+            --min-length $min_length
+        #end if 
+        $circular
+        #if $delta
+            --delta $delta
+            $only_complete_flanking
+        #end if
+        @TAXO_DIR_OPTIONAL@
+        @INPUT_FORMAT@
+        @OUT_FORMAT@
+        $input
+        >'$output'
+    ]]></command>
+    <inputs>
+        <param name="input" type="data" format="@INPUT_FORMATS@"/>
+        <param name="forward" type="text" optional="false" label="Sequence of the forward primer" help="The forward primer used for the electronic PCR. IUPAC codes can be used in the pattern."/>
+        <param name="reverse" type="text" optional="false" label="Sequence of the reverse primer" help="The reverse primer used for the electronic PCR. IUPAC codes can be used in the pattern."/>
+        <param name="max_length" type="integer" optional="false" label="Maximum length of the barcode, primers excluded."/>
+        <param name="min_length" type="integer" optional="true" label="Minimum length of the barcode, primers excluded."/>
+        <param name="allowed_mismatches" type="integer" value="0" label="Maximum number of mismatches allowed for each primer"/>
+        <param name="circular" type="boolean" truevalue="--circular" falsevalue="" label="Considers that sequences are circular. (default: sequences are considered linear)"/>
+        <section name="delta_option" title="delta_option">
+            <param name="delta" type="integer" optional="true" label="delta" help="Without this option, only the barcode sequences will be output, without the priming sites. This option allows to add the priming sites and the flanking sequences of the priming sites over a length of delta to each side of the barcode."/>
+            <param name="only_complete_flanking" optional="true" type="boolean" truevalue="--only-complete-flanking" falsevalue="" label="only complete flanking" help="Works in conjunction with –delta. Prints only sequences with full-length flanking sequences (default: prints every sequence regardless of whether the flanking sequences are present)."/>
+        </section>
+        <expand macro="taxo_macro_optional"/>
+        <expand macro="input_format_options_macro"/>
+        <expand macro="out_format_macro"/>
+    </inputs>
+    <outputs>
+        <data format_source="input" name="output">
+            <expand macro="change_format_macro"/>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="input_reference_dataset.fasta.gz"/>
+            <param name="forward" value="GGGCAATCCTGAGCCAA"/>
+            <param name="reverse" value="CCATTGAGTCTCTGCACCTATC"/>
+            <param name="max_length" value="220"/>
+            <param name="out_format" value="fasta"/>
+            <output name="output" file="output_obipcr.fasta" ftype="fasta"/>
+        </test>
+    </tests>
+    <help>
+        .. class:: infomark
+
+**What it does**
+
+The obipcr program is the successor of ecoPCR. It is known as an in silico PCR software.
+
+* forward                   : The forward primer used for the electronic PCR. IUPAC codes can be used in the pattern.
+
+* reverse                   : The reverse primer used for the electronic PCR. IUPAC codes can be used in the pattern.
+
+* max length                : Maximum length of the barcode, primers excluded.
+
+* min length                : Minimum length of the barcode primers excluded (default: no minimum length).
+
+* circular                  : Considers that sequences are circular. (default: sequences are considered linear)
+
+* delta                     : Without this option, only the barcode sequences will be output, without the priming sites. This option allows to add the priming sites and the flanking sequences of the priming sites over a length of delta to each side of the barcode.
+
+* only complete flanking    :  Works in conjunction with –delta. Prints only sequences with full-length flanking sequences (default: prints every sequence regardless of whether the flanking sequences are present).
+
+@OBITOOLS4_IMAGE@
+
+@OBITOOLS_LINK_OBI4@
+
+    </help>
+    <expand macro="citation" />
+
+</tool>

tools/obitools/obirefidx.xml

@@ -0,0 +1,52 @@
+<tool id="obi_refidx" name="obirefidx" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>
+        Index the database
+    </description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
+    <command><![CDATA[
+        obirefidx
+        --no-progressbar
+        @TAXO_DIR@
+        @INPUT_FORMAT@
+        @OUT_FORMAT@
+        $input
+        >'$output'
+    ]]></command>
+    <inputs>
+        <param name="input" type="data" format="@INPUT_FORMATS@"/>
+        <expand macro="taxo_macro"/>
+        <expand macro="input_format_options_macro"/>
+        <expand macro="out_format_macro"/>
+    </inputs>
+    <outputs>
+        <data format_source="input" name="output">
+            <expand macro="change_format_macro"/>
+        </data>
+    </outputs>
+    <tests>
+        <test expect_num_outputs="1">
+            <param name="input" value="db_v05_r117.fasta.gz" ftype="fasta.gz"/>
+            <conditional name="taxonomy">
+                <param name="taxonomy_source" value="history"/>
+                <param name="taxdump" value="taxdump_mammalia_old.csv.gz"/>
+            </conditional>
+            <output name="output" file="output_obirefidx_db.fasta.gz" ftype="fasta.gz"/>  
+        </test>
+    </tests>
+    <help>
+        .. class:: infomark
+
+**What it does**
+
+
+
+@OBITOOLS_LINK_OBI4@
+
+    </help>
+    <expand macro="citation" />
+
+</tool>