obipcr.xml

<tool id="obi_pcr" name="obipcr" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
    <description>
        In sillico PCR
    </description>
    <macros>
        <import>macros.xml</import>
    </macros>
    <expand macro="requirements"/>
    <expand macro="stdio"/>
    <command><![CDATA[
        obipcr
        --no-progressbar
        --forward $forward
        --reverse $reverse
        --max-length $max_length
        -e $allowed_mismatches
        #if $min_length
            --min-length $min_length
        #end if 
        $circular
        #if $delta
            --delta $delta
            $only_complete_flanking
        #end if
        @TAXO_DIR_OPTIONAL@
        @INPUT_FORMAT@
        @OUT_FORMAT@
        $input
        >'$output'
    ]]></command>
    <inputs>
        <param name="input" type="data" format="@INPUT_FORMATS@"/>
        <param name="forward" type="text" optional="false" label="Sequence of the forward primer" help="The forward primer used for the electronic PCR. IUPAC codes can be used in the pattern."/>
        <param name="reverse" type="text" optional="false" label="Sequence of the reverse primer" help="The reverse primer used for the electronic PCR. IUPAC codes can be used in the pattern."/>
        <param name="max_length" type="integer" optional="false" label="Maximum length of the barcode, primers excluded."/>
        <param name="min_length" type="integer" optional="true" label="Minimum length of the barcode, primers excluded."/>
        <param name="allowed_mismatches" type="integer" value="0" label="Maximum number of mismatches allowed for each primer"/>
        <param name="circular" type="boolean" truevalue="--circular" falsevalue="" label="Considers that sequences are circular. (default: sequences are considered linear)"/>
        <section name="delta_option" title="delta_option">
            <param name="delta" type="integer" optional="true" label="delta" help="Without this option, only the barcode sequences will be output, without the priming sites. This option allows to add the priming sites and the flanking sequences of the priming sites over a length of delta to each side of the barcode."/>
            <param name="only_complete_flanking" optional="true" type="boolean" truevalue="--only-complete-flanking" falsevalue="" label="only complete flanking" help="Works in conjunction with –delta. Prints only sequences with full-length flanking sequences (default: prints every sequence regardless of whether the flanking sequences are present)."/>
        </section>
        <expand macro="taxo_macro_optional"/>
        <expand macro="input_format_options_macro"/>
        <expand macro="out_format_macro"/>
    </inputs>
    <outputs>
        <data format_source="input" name="output">
            <expand macro="change_format_macro"/>
        </data>
    </outputs>
    <tests>
        <test>
            <param name="input" value="input_reference_dataset.fasta.gz"/>
            <param name="forward" value="GGGCAATCCTGAGCCAA"/>
            <param name="reverse" value="CCATTGAGTCTCTGCACCTATC"/>
            <param name="max_length" value="220"/>
            <param name="out_format" value="fasta"/>
            <output name="output" file="output_obipcr.fasta" ftype="fasta"/>
        </test>
    </tests>
    <help>
        .. class:: infomark

**What it does**

The obipcr program is the successor of ecoPCR. It is known as an in silico PCR software.

* forward                   : The forward primer used for the electronic PCR. IUPAC codes can be used in the pattern.

* reverse                   : The reverse primer used for the electronic PCR. IUPAC codes can be used in the pattern.

* max length                : Maximum length of the barcode, primers excluded.

* min length                : Minimum length of the barcode primers excluded (default: no minimum length).

* circular                  : Considers that sequences are circular. (default: sequences are considered linear)

* delta                     : Without this option, only the barcode sequences will be output, without the priming sites. This option allows to add the priming sites and the flanking sequences of the priming sites over a length of delta to each side of the barcode.

* only complete flanking    :  Works in conjunction with –delta. Prints only sequences with full-length flanking sequences (default: prints every sequence regardless of whether the flanking sequences are present).

@OBITOOLS4_IMAGE@

@OBITOOLS_LINK_OBI4@

    </help>
    <expand macro="citation" />

</tool>