-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
1 parent
19ea831
commit 3f25087
Showing
7 changed files
with
48 additions
and
18 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,14 +1,14 @@ | ||
>Header1 5bp sequence with no gaps and 2 lowercase bases | ||
CGacT | ||
CGaTT | ||
|
||
>Header2 5bp sequence with internal 1bp non-canonical gap | ||
CGAXT | ||
|
||
>Header3 10bp sequence with internal 4bp and 1bp terminal canonical gap | ||
TGANATNCTN | ||
TAANATNCTN | ||
|
||
>Header4 15bp sequence with start 3bp canonical gap and 3 lowercase bases | ||
NNNTTCCTcgCACtC | ||
NNNTTCCTcgCACtT | ||
|
||
>Header5 15bp sequence with terminal 3bp canonical gap | ||
AACTCGATCACGNNN | ||
AACTCGATCATTNNN |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,5 +1,5 @@ | ||
>Header1_low_entropy | ||
TTTTTTTTTAAGGGGGGGGG | ||
TTTTTTTTTAGGGGGGGGGG | ||
|
||
>Header2_fully_compressible | ||
TTTTTTTTTTAAAAAAAAAA | ||
|
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +1,12 @@ | ||
testFiles/random1.fasta -w 3 -s 1 | ||
embedded | ||
testFiles/random1.fasta -w 3 -s 1 -p TT | ||
embedded | ||
/// Teloscope v0.0.1 | ||
Waiting for jobs to complete | ||
All jobs completed | ||
Reporting window matches and metrics in BED/BEDgraphs... | ||
|
||
+++Summary Report+++ | ||
Total windows analyzed: 40 | ||
Total input patterns found: | ||
Pattern: AA 2 | ||
Pattern: TT 4 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +1,12 @@ | ||
testFiles/random2.fasta -w 10 -s 5 | ||
embedded | ||
testFiles/random2.fasta -w 10 -s 5 -p TTAGGG | ||
embedded | ||
/// Teloscope v0.0.1 | ||
Waiting for jobs to complete | ||
All jobs completed | ||
Reporting window matches and metrics in BED/BEDgraphs... | ||
|
||
+++Summary Report+++ | ||
Total windows analyzed: 21 | ||
Total input patterns found: | ||
Pattern: CCCTAA 3 | ||
Pattern: TTAGGG 8 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +1,12 @@ | ||
testFiles/random3.fasta -w 10 -s 5 | ||
embedded | ||
testFiles/random3.fasta -w 10 -s 5 -p TTAGGG | ||
embedded | ||
/// Teloscope v0.0.1 | ||
Waiting for jobs to complete | ||
All jobs completed | ||
Reporting window matches and metrics in BED/BEDgraphs... | ||
|
||
+++Summary Report+++ | ||
Total windows analyzed: | ||
Total input patterns found: | ||
Pattern: CCCTAA 0 | ||
Pattern: TTAGGG 1 |