Wolfgang's DNA Codec

Cultivate your data!

Usage

dna-codec.py <input> <args>

Flag	Description	Default
--encode	Encode	Yes
--columns:	Split result into columns	No / 0
--decode	Decode	No
--codec:<codec>	Which encoder to use?	utf_8
--string	Input a string	Yes
--file	Input a file	No
--raw	Raw input & output	No
--strict	Don't skip bad data	No
--help	Display some help	No

Examples

Encode a string: dna-codec.py "Hello, world!" --encode

Decode a string: dna-codec.py CCCACGGACGCCAGAACACTCGACCGTCCGCC --decode

Decode a file: dna-codec.py dna.txt --decode --file

Encode a binary file: dna-codec.py rosie.jxl --encode --file --raw

Decode a string with a specific codec: dna-codec.py "Hello, world!" --decode --codec:utf_16

Encode a file and store the output: dna-codec.py data.txt --encode --file > output.txt

---

CGAGCTGCAGAACCCTCGTTCGTACGCGCGCTCGACCGTGCGCTAGAACGCACGCCAGAACACTCTAGCGTTCGTTCTCA