Updating workflows/virology/influenza-isolates-consensus-and-subtyping from 0.2 to 0.3 #863

gxydevbot · 2025-05-19T05:45:41Z

Hello! This is an automated update of the following workflow: workflows/virology/influenza-isolates-consensus-and-subtyping. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

toolshed.g2.bx.psu.edu/repos/iuc/iqtree/iqtree/2.4.0+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/iuc/iqtree/iqtree/2.4.0+galaxy1

The workflow release number has been updated from 0.2 to 0.3.

If you want to skip this change, close this PR without deleting the branch. It will be reopened if another change is detected.
Any commit from another author than 'planemo-autoupdate' will prevent more auto-updates.
To ignore manual changes and allow autoupdates, delete the branch.

gxydevbot · 2025-06-09T07:04:43Z

There are new updates, they have been integrated to the PR, check the file diff.

…g from 0.2 to 0.3

gxydevbot · 2025-06-16T06:26:28Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2025-06-16T06:47:16Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ influenza-consensus-and-subtyping.ga_0

Problems:

Output with path /tmp/tmp10v97eea/VAPOR on data 42, data 34, and data 54 closest reference scores__cda3f235-eecc-4ee0-9a03-5025dc303474 different than expected
Expected text '0.9929078014184397	6935928.0	1410	4919.097872340426	34376	>NA|A/Texas/50/2012|A/H3N2|KJ942618.1' in output ('0.9929078014184397	6935876.0	1410	4919.060992907802	34376	>NA|A/Texas/50/2012|A/H3N2|KJ942618.1
0.9886524822695035	6917545.0	1410	4906.060283687943	34376	>NA|A/Victoria/361/2011|A/H3N2|KJ942682.1
0.9872340425531915	6852784.0	1410	4860.1304964539	34376	>NA|A/Netherlands/10407/2018|A/H1N2
0.9787234042553191	6824103.0	1410	4839.789361702127	34376	>NA|A/Perth/16/2009|A/H3N2|KJ609208.1
0.8588652482269503	5994234.0	1410	4251.229787234042	34376	>NA|A/Singapore/1/1957|A/H2N2|CY125896.1
')

Workflow invocation details

Invocation Messages

Steps

Step 1: References per segment collection:
- step_state: scheduled
Step 2: Sequenced paired-end data:
- step_state: scheduled

Step 11: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 12: __DUPLICATE_FILE_TO_COLLECTION__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier "segment"
      
      number "2"
  - Job 2:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier "segment"
      
      number "2"
Step 13: __DUPLICATE_FILE_TO_COLLECTION__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier "1"
      
      number "2"
Step 14: __DUPLICATE_FILE_TO_COLLECTION__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier "segment"
      
      number "2"
  - Job 2:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier "segment"
      
      number "2"
Step 15: __DUPLICATE_FILE_TO_COLLECTION__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier "seq"
      
      number "2"
  - Job 2:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier "seq"
      
      number "2"

Step 16: __RELABEL_FROM_FILE__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
how	`{"__current_case__": 0, "how_select": "txt", "labels": {"values": [{"id": 8, "src": "hda"}]}, "strict": true}`
input	`{"values": [{"id": 8, "src": "hdca"}]}`

Step 17: __APPLY_RULES__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
input	`{"values": [{"id": 11, "src": "hdca"}]}`
rules	`{"mapping": [{"columns": [1, 0], "editing": false, "type": "list_identifiers"}], "rules": [{"error": null, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"error": null, "type": "add_column_metadata", "value": "identifier1", "warn": null}]}`

Step 18: __DUPLICATE_FILE_TO_COLLECTION__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier None
      
      number "2"
  - Job 2:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      element_identifier None
      
      number "2"

Step 19: __RELABEL_FROM_FILE__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
how	`{"__current_case__": 0, "how_select": "txt", "labels": {"values": [{"id": 9, "src": "hda"}]}, "strict": true}`
input	`{"values": [{"id": 12, "src": "hdca"}]}`

Step 20: __APPLY_RULES__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
input	`{"values": [{"id": 13, "src": "hdca"}]}`
rules	`{"mapping": [{"columns": [1, 0], "editing": false, "type": "list_identifiers"}], "rules": [{"error": null, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"error": null, "type": "add_column_metadata", "value": "identifier1", "warn": null}]}`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

times=1; yes -- '' 2>/dev/null | head -n $times >> '/tmp/tmp02xatkiv/job_working_directory/000/7/outputs/dataset_843dfc25-2610-4738-907b-5f9516e75c4d.dat';

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
token_set	`[{"__index__": 0, "line": null, "repeat_select": {"__current_case__": 0, "repeat_select_opts": "user", "times": "1"}}]`

Step 21: toolshed.g2.bx.psu.edu/repos/iuc/vapor/vapor/1.0.2+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

awk '{ if ($0 !~ />/) {print toupper($0)} else {print $0} }' '/tmp/tmp02xatkiv/files/a/6/0/dataset_a60bafee-7e01-4228-b609-0540856be54f.dat' > ref_upper.fa &&  ln -s '/tmp/tmp02xatkiv/files/1/1/5/dataset_115745c3-506b-4717-8f86-3c0818350abc.dat' fastq1.fastqsanger.gz && ln -s '/tmp/tmp02xatkiv/files/0/c/7/dataset_0c74f579-c4bd-4eec-bdd5-2176ad08ff28.dat' fastq2.fastqsanger.gz && vapor.py --return_best_n 500 -k 21 -t 0.1 -c 5 -m 0.1 -fa 'ref_upper.fa' -fq fastq1.fastqsanger.gz fastq2.fastqsanger.gz -f 1.0 > out_file

Exit Code:

```
0
```

Standard Error:

Loading database sequences
Got 56 unique sequences
Getting database kmers
Got 62234 database kmers
Filtering reads
15102 of 167100 reads survived
Building wDBG
Got 73692 wdbg kmers
Culling kmers with coverage under 5 
4962 kmers remaining
Classifying

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 1, "fastq1": {"values": [{"id": 23, "src": "dce"}]}, "fastq2": {"values": [{"id": 31, "src": "dce"}]}, "fastq_input_selector": "paired"}`
opt	`{"kmer_length": "21", "min_kmer_cov": "5", "min_kmer_prop": "0.1", "threshold": "0.1", "top_seed_frac": "1.0"}`
output_type	`"scores"`
return_best_n	`"500"`

Job 2:

Job state is ok

Command Line:

awk '{ if ($0 !~ />/) {print toupper($0)} else {print $0} }' '/tmp/tmp02xatkiv/files/8/3/e/dataset_83e1099f-b541-4eb9-bb36-9cfea5db37df.dat' > ref_upper.fa &&  ln -s '/tmp/tmp02xatkiv/files/1/1/5/dataset_115745c3-506b-4717-8f86-3c0818350abc.dat' fastq1.fastqsanger.gz && ln -s '/tmp/tmp02xatkiv/files/0/c/7/dataset_0c74f579-c4bd-4eec-bdd5-2176ad08ff28.dat' fastq2.fastqsanger.gz && vapor.py --return_best_n 500 -k 21 -t 0.1 -c 5 -m 0.1 -fa 'ref_upper.fa' -fq fastq1.fastqsanger.gz fastq2.fastqsanger.gz -f 1.0 > out_file

Exit Code:

```
0
```

Standard Error:

Loading database sequences
Got 56 unique sequences
Getting database kmers
Got 51418 database kmers
Filtering reads
20424 of 167100 reads survived
Building wDBG
Got 94442 wdbg kmers
Culling kmers with coverage under 5 
7243 kmers remaining
Classifying

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 1, "fastq1": {"values": [{"id": 24, "src": "dce"}]}, "fastq2": {"values": [{"id": 32, "src": "dce"}]}, "fastq_input_selector": "paired"}`
opt	`{"kmer_length": "21", "min_kmer_cov": "5", "min_kmer_prop": "0.1", "threshold": "0.1", "top_seed_frac": "1.0"}`
output_type	`"scores"`
return_best_n	`"500"`

Job 3:

Job state is ok

Command Line:

awk '{ if ($0 !~ />/) {print toupper($0)} else {print $0} }' '/tmp/tmp02xatkiv/files/a/6/0/dataset_a60bafee-7e01-4228-b609-0540856be54f.dat' > ref_upper.fa &&  ln -s '/tmp/tmp02xatkiv/files/7/7/f/dataset_77f6c98d-1dbb-4292-a624-9d565942d236.dat' fastq1.fastqsanger.gz && ln -s '/tmp/tmp02xatkiv/files/e/2/f/dataset_e2fba24b-5bee-472d-826a-6bfe396f86f9.dat' fastq2.fastqsanger.gz && vapor.py --return_best_n 500 -k 21 -t 0.1 -c 5 -m 0.1 -fa 'ref_upper.fa' -fq fastq1.fastqsanger.gz fastq2.fastqsanger.gz -f 1.0 > out_file

Exit Code:

```
0
```

Standard Error:

Loading database sequences
Got 56 unique sequences
Getting database kmers
Got 62234 database kmers
Filtering reads
60505 of 344830 reads survived
Building wDBG
Got 105011 wdbg kmers
Culling kmers with coverage under 5 
13348 kmers remaining
Classifying

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 1, "fastq1": {"values": [{"id": 25, "src": "dce"}]}, "fastq2": {"values": [{"id": 33, "src": "dce"}]}, "fastq_input_selector": "paired"}`
opt	`{"kmer_length": "21", "min_kmer_cov": "5", "min_kmer_prop": "0.1", "threshold": "0.1", "top_seed_frac": "1.0"}`
output_type	`"scores"`
return_best_n	`"500"`

Job 4:

Job state is ok

Command Line:

awk '{ if ($0 !~ />/) {print toupper($0)} else {print $0} }' '/tmp/tmp02xatkiv/files/8/3/e/dataset_83e1099f-b541-4eb9-bb36-9cfea5db37df.dat' > ref_upper.fa &&  ln -s '/tmp/tmp02xatkiv/files/7/7/f/dataset_77f6c98d-1dbb-4292-a624-9d565942d236.dat' fastq1.fastqsanger.gz && ln -s '/tmp/tmp02xatkiv/files/e/2/f/dataset_e2fba24b-5bee-472d-826a-6bfe396f86f9.dat' fastq2.fastqsanger.gz && vapor.py --return_best_n 500 -k 21 -t 0.1 -c 5 -m 0.1 -fa 'ref_upper.fa' -fq fastq1.fastqsanger.gz fastq2.fastqsanger.gz -f 1.0 > out_file

Exit Code:

```
0
```

Standard Error:

Loading database sequences
Got 56 unique sequences
Getting database kmers
Got 51418 database kmers
Filtering reads
34376 of 344830 reads survived
Building wDBG
Got 74729 wdbg kmers
Culling kmers with coverage under 5 
7468 kmers remaining
Classifying

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 1, "fastq1": {"values": [{"id": 26, "src": "dce"}]}, "fastq2": {"values": [{"id": 34, "src": "dce"}]}, "fastq_input_selector": "paired"}`
opt	`{"kmer_length": "21", "min_kmer_cov": "5", "min_kmer_prop": "0.1", "threshold": "0.1", "top_seed_frac": "1.0"}`
output_type	`"scores"`
return_best_n	`"500"`

Step 22: __FLATTEN__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      input {"values": [{"id": 14, "src": "hdca"}]}
      
      join_identifier ":"

Step 23: __RELABEL_FROM_FILE__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
how	`{"__current_case__": 0, "how_select": "txt", "labels": {"values": [{"id": 9, "src": "hda"}]}, "strict": false}`
input	`{"values": [{"id": 15, "src": "hdca"}]}`

Step 24: __FILTER_FAILED_DATASETS__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      input {"values": [{"id": 67, "src": "dce"}]}
      
      replacement None
  - Job 2:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      input {"values": [{"id": 70, "src": "dce"}]}
      
      replacement None
Step 25: __FLATTEN__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      input {"values": [{"id": 18, "src": "hdca"}]}
      
      join_identifier ":"

Step 26: __APPLY_RULES__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
input	`{"values": [{"id": 20, "src": "hdca"}]}`
rules	`{"mapping": [{"columns": [0, 1], "editing": false, "type": "list_identifiers"}], "rules": [{"error": null, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"error": null, "type": "add_column_metadata", "value": "identifier1", "warn": null}]}`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/41/outputs/dataset_ed3c07df-039e-488b-90a9-e70368f0ac1c.dat'     -r '^.+\t>(.+)$' '$1' '/tmp/tmp02xatkiv/files/4/d/f/dataset_4df8ca3d-dcc1-4469-b7b0-73997e038f8f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^.+\\t>(.+)$", "global": false, "is_regex": true, "replace_pattern": "$1", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Job 2:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/42/outputs/dataset_8a64ed29-5334-4da1-a401-fbfe9279568f.dat'     -r '^.+\t>(.+)$' '$1' '/tmp/tmp02xatkiv/files/a/8/2/dataset_a8292654-60cb-4edf-a50b-0827ba5c9e94.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^.+\\t>(.+)$", "global": false, "is_regex": true, "replace_pattern": "$1", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Job 3:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/43/outputs/dataset_c762f8ff-8f7f-49f8-82cb-16061d52ddb7.dat'     -r '^.+\t>(.+)$' '$1' '/tmp/tmp02xatkiv/files/3/d/e/dataset_3de688ec-4a50-4902-a16e-ac85b7d89066.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^.+\\t>(.+)$", "global": false, "is_regex": true, "replace_pattern": "$1", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Job 4:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/44/outputs/dataset_c21d148c-6d07-4bbe-96cf-3bfafed9013c.dat'     -r '^.+\t>(.+)$' '$1' '/tmp/tmp02xatkiv/files/c/d/a/dataset_cda3f235-eecc-4ee0-9a03-5025dc303474.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^.+\\t>(.+)$", "global": false, "is_regex": true, "replace_pattern": "$1", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 28: Show beginning1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

head -n 1 '/tmp/tmp02xatkiv/files/e/d/3/dataset_ed3c07df-039e-488b-90a9-e70368f0ac1c.dat' > '/tmp/tmp02xatkiv/job_working_directory/000/45/outputs/dataset_e2762534-968b-4cea-ae6d-f04e6d2db014.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
header	`false`
lineNum	`"1"`

Job 2:

Job state is ok

Command Line:

head -n 1 '/tmp/tmp02xatkiv/files/8/a/6/dataset_8a64ed29-5334-4da1-a401-fbfe9279568f.dat' > '/tmp/tmp02xatkiv/job_working_directory/000/46/outputs/dataset_7fdb8017-1781-4153-a03c-c80eb6e2cde3.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
header	`false`
lineNum	`"1"`

Job 3:

Job state is ok

Command Line:

head -n 1 '/tmp/tmp02xatkiv/files/c/7/6/dataset_c762f8ff-8f7f-49f8-82cb-16061d52ddb7.dat' > '/tmp/tmp02xatkiv/job_working_directory/000/47/outputs/dataset_06605ef5-dd97-4036-90aa-eaf6908eaa42.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
header	`false`
lineNum	`"1"`

Job 4:

Job state is ok

Command Line:

head -n 1 '/tmp/tmp02xatkiv/files/c/2/1/dataset_c21d148c-6d07-4bbe-96cf-3bfafed9013c.dat' > '/tmp/tmp02xatkiv/job_working_directory/000/48/outputs/dataset_4a1661fb-8555-4eca-8b48-d91c2157fd7f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
header	`false`
lineNum	`"1"`

Step 29: __FLATTEN__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      input {"values": [{"id": 23, "src": "hdca"}]}
      
      join_identifier ":"

Step 30: toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

(   cat "/tmp/tmp02xatkiv/files/e/2/7/dataset_e2762534-968b-4cea-ae6d-f04e6d2db014.dat" ;   cat "/tmp/tmp02xatkiv/files/7/f/d/dataset_7fdb8017-1781-4153-a03c-c80eb6e2cde3.dat" ;   ) > /tmp/tmp02xatkiv/job_working_directory/000/50/outputs/dataset_80196435-95a2-4208-bc68-8193c71b5a7b.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filename	`{"__current_case__": 1, "add_name": false}`
one_header	`false`

Job 2:

Job state is ok

Command Line:

(   cat "/tmp/tmp02xatkiv/files/0/6/6/dataset_06605ef5-dd97-4036-90aa-eaf6908eaa42.dat" ;   cat "/tmp/tmp02xatkiv/files/4/a/1/dataset_4a1661fb-8555-4eca-8b48-d91c2157fd7f.dat" ;   ) > /tmp/tmp02xatkiv/job_working_directory/000/51/outputs/dataset_00676dcd-08ac-4c4f-9561-15c524a73681.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filename	`{"__current_case__": 1, "add_name": false}`
one_header	`false`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mv '/tmp/tmp02xatkiv/job_working_directory/000/8/configs/tmph7gmnbkn' '/tmp/tmp02xatkiv/job_working_directory/000/8/outputs/dataset_d58804ea-ae25-4405-b7c0-ca80850c48b2.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_collection	`{"values": [{"id": 1, "src": "hdca"}]}`

Step 31: __MERGE_COLLECTION__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
advanced	`{"conflict": {"__current_case__": 3, "duplicate_options": "keep_first"}}`
inputs	`[{"__index__": 0, "input": {"values": [{"id": 24, "src": "hdca"}]}}, {"__index__": 1, "input": {"values": [{"id": 19, "src": "hdca"}]}}]`

Step 32: Grep1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -eo pipefail; cat '/tmp/tmp02xatkiv/files/8/0/1/dataset_80196435-95a2-4208-bc68-8193c71b5a7b.dat' | grep -P -f '/tmp/tmp02xatkiv/job_working_directory/000/53/configs/tmpibf10i2z'  >> '/tmp/tmp02xatkiv/job_working_directory/000/53/outputs/dataset_bb8f3034-d765-4fab-a81a-d9b132804a8b.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
invert	`""`
keep_header	`false`
pattern	`"^HA.+"`

Job 2:

Job state is ok

Command Line:

set -eo pipefail; cat '/tmp/tmp02xatkiv/files/0/0/6/dataset_00676dcd-08ac-4c4f-9561-15c524a73681.dat' | grep -P -f '/tmp/tmp02xatkiv/job_working_directory/000/54/configs/tmpt_350fd6'  >> '/tmp/tmp02xatkiv/job_working_directory/000/54/outputs/dataset_43543432-5077-49f4-bf87-fcee39d5e05a.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
invert	`""`
keep_header	`false`
pattern	`"^HA.+"`

Step 33: Grep1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -eo pipefail; cat '/tmp/tmp02xatkiv/files/8/0/1/dataset_80196435-95a2-4208-bc68-8193c71b5a7b.dat' | grep -P -f '/tmp/tmp02xatkiv/job_working_directory/000/55/configs/tmposvlmb_b'  >> '/tmp/tmp02xatkiv/job_working_directory/000/55/outputs/dataset_4e0fb049-0f2b-4550-9966-41ef06131362.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
invert	`""`
keep_header	`false`
pattern	`"^NA.+"`

Job 2:

Job state is ok

Command Line:

set -eo pipefail; cat '/tmp/tmp02xatkiv/files/0/0/6/dataset_00676dcd-08ac-4c4f-9561-15c524a73681.dat' | grep -P -f '/tmp/tmp02xatkiv/job_working_directory/000/56/configs/tmpbicdlwne'  >> '/tmp/tmp02xatkiv/job_working_directory/000/56/outputs/dataset_ce84cb14-6a48-46d2-b90d-e510ea8ff843.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
invert	`""`
keep_header	`false`
pattern	`"^NA.+"`

Step 34: __HARMONIZELISTS__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
input1	`{"values": [{"id": 17, "src": "hdca"}]}`
input2	`{"values": [{"id": 26, "src": "hdca"}]}`

Step 35: Paste1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp02xatkiv/galaxy-dev/tools/filters/pasteWrapper.pl' '/tmp/tmp02xatkiv/files/b/b/8/dataset_bb8f3034-d765-4fab-a81a-d9b132804a8b.dat' '/tmp/tmp02xatkiv/files/4/e/0/dataset_4e0fb049-0f2b-4550-9966-41ef06131362.dat' T '/tmp/tmp02xatkiv/job_working_directory/000/58/outputs/dataset_f15d010e-84ec-462a-824d-82bcd66b185e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
delimiter	`"T"`

Job 2:

Job state is ok

Command Line:

perl '/tmp/tmp02xatkiv/galaxy-dev/tools/filters/pasteWrapper.pl' '/tmp/tmp02xatkiv/files/4/3/5/dataset_43543432-5077-49f4-bf87-fcee39d5e05a.dat' '/tmp/tmp02xatkiv/files/c/e/8/dataset_ce84cb14-6a48-46d2-b90d-e510ea8ff843.dat' T '/tmp/tmp02xatkiv/job_working_directory/000/59/outputs/dataset_a75211b8-f50c-4cc9-8275-8e982a7a7d54.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
delimiter	`"T"`

Step 36: __APPLY_RULES__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
input	`{"values": [{"id": 30, "src": "hdca"}]}`
rules	{"mapping": [{"collapsible_value": {"__class__": "RuntimeValue"}, "columns": [1, 2], "connectable": true, "editing": false, "is_workflow": false, "type": "list_identifiers"}], "rules": [{"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "expression": "(.+):(.+)", "group_count": 2, "is_workflow": false, "replacement": null, "target_column": 0, "type": "add_column_regex", "warn": null}]}

Step 37: toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

(   awk '{print "SRR24839074\t"$0} END { if (NR == 0 && NF == 0) { print "SRR24839074\t" } }' "/tmp/tmp02xatkiv/files/f/1/5/dataset_f15d010e-84ec-462a-824d-82bcd66b185e.dat";   awk '{print "SRR6674560\t"$0} END { if (NR == 0 && NF == 0) { print "SRR6674560\t" } }' "/tmp/tmp02xatkiv/files/a/7/5/dataset_a75211b8-f50c-4cc9-8275-8e982a7a7d54.dat";   ) > /tmp/tmp02xatkiv/job_working_directory/000/60/outputs/dataset_9861115f-baa5-4422-8974-9c2a009218ff.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filename	`{"__current_case__": 0, "add_name": true, "place_name": "same_multiple"}`
one_header	`false`

Step 38: toolshed.g2.bx.psu.edu/repos/iuc/seqtk/seqtk_subseq/1.4+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

seqtk subseq  -l 0 '/tmp/tmp02xatkiv/files/a/6/0/dataset_a60bafee-7e01-4228-b609-0540856be54f.dat' '/tmp/tmp02xatkiv/files/e/2/7/dataset_e2762534-968b-4cea-ae6d-f04e6d2db014.dat'  > '/tmp/tmp02xatkiv/job_working_directory/000/65/outputs/dataset_173aaa2a-d2d6-4dc4-9fa6-36bc3926a851.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
l	`"0"`
source	`{"__current_case__": 1, "name_list": {"values": [{"id": 136, "src": "dce"}]}, "type": "name"}`
t	`false`

Job 2:

Job state is ok

Command Line:

seqtk subseq  -l 0 '/tmp/tmp02xatkiv/files/8/3/e/dataset_83e1099f-b541-4eb9-bb36-9cfea5db37df.dat' '/tmp/tmp02xatkiv/files/7/f/d/dataset_7fdb8017-1781-4153-a03c-c80eb6e2cde3.dat'  > '/tmp/tmp02xatkiv/job_working_directory/000/66/outputs/dataset_8f666e19-1561-4feb-b665-37347fdf8199.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
l	`"0"`
source	`{"__current_case__": 1, "name_list": {"values": [{"id": 137, "src": "dce"}]}, "type": "name"}`
t	`false`

Job 3:

Job state is ok

Command Line:

seqtk subseq  -l 0 '/tmp/tmp02xatkiv/files/a/6/0/dataset_a60bafee-7e01-4228-b609-0540856be54f.dat' '/tmp/tmp02xatkiv/files/0/6/6/dataset_06605ef5-dd97-4036-90aa-eaf6908eaa42.dat'  > '/tmp/tmp02xatkiv/job_working_directory/000/67/outputs/dataset_7ffeba80-3b07-44aa-bac5-9efe072ff63f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
l	`"0"`
source	`{"__current_case__": 1, "name_list": {"values": [{"id": 139, "src": "dce"}]}, "type": "name"}`
t	`false`

Job 4:

Job state is ok

Command Line:

seqtk subseq  -l 0 '/tmp/tmp02xatkiv/files/8/3/e/dataset_83e1099f-b541-4eb9-bb36-9cfea5db37df.dat' '/tmp/tmp02xatkiv/files/4/a/1/dataset_4a1661fb-8555-4eca-8b48-d91c2157fd7f.dat'  > '/tmp/tmp02xatkiv/job_working_directory/000/68/outputs/dataset_1f77fb7d-e538-4d68-825f-88d3ac449142.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
l	`"0"`
source	`{"__current_case__": 1, "name_list": {"values": [{"id": 140, "src": "dce"}]}, "type": "name"}`
t	`false`

Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/sort-header' ./ && chmod +x sort-header && perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/easyjoin' -v 1 -t $'\t'  -e 'H?N?' -o auto  -1 '1' -2 '1' '/tmp/tmp02xatkiv/files/1/1/f/dataset_11f11b2a-76b4-4223-9d67-91cf3d4b8b5f.dat' '/tmp/tmp02xatkiv/files/9/8/6/dataset_9861115f-baa5-4422-8974-9c2a009218ff.dat' > '/tmp/tmp02xatkiv/job_working_directory/000/61/outputs/dataset_68460122-35ae-41f1-bbc9-92f4e139c632.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column1	`"1"`
column2	`"1"`
dbkey	`"?"`
empty_string_filler	`"H?N?"`
header	`false`
ignore_case	`false`
jointype	`"-v 1"`

Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace'     -r '^(.+\t)(\t.*)$' '$1H?$2' '/tmp/tmp02xatkiv/files/9/8/6/dataset_9861115f-baa5-4422-8974-9c2a009218ff.dat' | perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace'     -r '^(.+\t)$' '$1N?' | perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace'     -r '^(.+\t)HA.+\|.*(H\d{1,2})N\d{1,2}\|[^|]+(\t.+)$' '$1$2$3' | perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace'     -r '(.+\t)(.+\t)NA.+\|.*H\d{1,2}(N\d{1,2})\|.+$' '$1$2$3' | perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/62/outputs/dataset_77417b72-2bf8-4e66-bacd-e6317756c9eb.dat'     -r '^(.+\t)(.+)\t(.+)$' '$1$2$3'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	` [{"index": 0, "caseinsensitive": false, "find_pattern": "^(.+\t)(\t.)$", "global": false, "is_regex": true, "replace_pattern": "$1H?$2", "searchwhere": {"current_case": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}, {"index": 1, "caseinsensitive": false, "find_pattern": "^(.+\t)$", "global": false, "is_regex": true, "replace_pattern": "$1N?", "searchwhere": {"current_case": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}, {"index": 2, "caseinsensitive": false, "find_pattern": "^(.+\t)HA.+\|.(H\d{1,2})N\d{1,2}\|[^

Step 5: toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mv '/tmp/tmp02xatkiv/job_working_directory/000/9/configs/tmpz5p2ntqh' '/tmp/tmp02xatkiv/job_working_directory/000/9/outputs/dataset_11f11b2a-76b4-4223-9d67-91cf3d4b8b5f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastqsanger.gz"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_collection	`{"values": [{"id": 2, "src": "hdca"}]}`

Step 41: toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

(   cat "/tmp/tmp02xatkiv/files/1/7/3/dataset_173aaa2a-d2d6-4dc4-9fa6-36bc3926a851.dat" ;   cat "/tmp/tmp02xatkiv/files/8/f/6/dataset_8f666e19-1561-4feb-b665-37347fdf8199.dat" ;   ) > /tmp/tmp02xatkiv/job_working_directory/000/69/outputs/dataset_cd224fa0-158a-492e-b8ae-6f977a8750ca.dat

Exit Code:

```
0
```

Standard Error:

  File "/tmp/tmp02xatkiv/galaxy-dev/lib/galaxy/web_stack/__init__.py", line 210, in run_postfork

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filename	`{"__current_case__": 1, "add_name": false}`
one_header	`false`

Job 2:

Job state is ok

Command Line:

(   cat "/tmp/tmp02xatkiv/files/7/f/f/dataset_7ffeba80-3b07-44aa-bac5-9efe072ff63f.dat" ;   cat "/tmp/tmp02xatkiv/files/1/f/7/dataset_1f77fb7d-e538-4d68-825f-88d3ac449142.dat" ;   ) > /tmp/tmp02xatkiv/job_working_directory/000/70/outputs/dataset_8e883f99-dcf8-45b9-aadf-df410d7fc656.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filename	`{"__current_case__": 1, "add_name": false}`
one_header	`false`

Step 42: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp02xatkiv/files/7/7/4/dataset_77417b72-2bf8-4e66-bacd-e6317756c9eb.dat' >> '/tmp/tmp02xatkiv/job_working_directory/000/63/outputs/dataset_c43029ac-000c-43ce-9a5b-3f6010453231.dat' && cat '/tmp/tmp02xatkiv/files/6/8/4/dataset_68460122-35ae-41f1-bbc9-92f4e139c632.dat' >> '/tmp/tmp02xatkiv/job_working_directory/000/63/outputs/dataset_c43029ac-000c-43ce-9a5b-3f6010453231.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 105, "src": "hda"}]}}]`

Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/71/outputs/dataset_ad7d4b5e-e5d6-4ef6-9586-7ca3f4fe5a85.dat'     -r '>([^|]+).+$' '>$1' '/tmp/tmp02xatkiv/files/c/d/2/dataset_cd224fa0-158a-492e-b8ae-6f977a8750ca.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	` [{"index": 0, "caseinsensitive": false, "find_pattern": ">([^

Job 2:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/72/outputs/dataset_99b9aa3e-c21d-4b88-8526-9fe4da405b93.dat'     -r '>([^|]+).+$' '>$1' '/tmp/tmp02xatkiv/files/8/e/8/dataset_8e883f99-dcf8-45b9-aadf-df410d7fc656.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	` [{"index": 0, "caseinsensitive": false, "find_pattern": ">([^

Step 44: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.19:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;  ln -s '/tmp/tmp02xatkiv/files/a/d/7/dataset_ad7d4b5e-e5d6-4ef6-9586-7ca3f4fe5a85.dat' 'localref.fa' && bwa index 'localref.fa' &&    bwa mem  -t "${GALAXY_SLOTS:-1}" -v 1                            -R '@RG\tID:SRR24839074\tSM:SRR24839074\tPL:ILLUMINA'   'localref.fa' '/tmp/tmp02xatkiv/files/1/1/5/dataset_115745c3-506b-4717-8f86-3c0818350abc.dat' '/tmp/tmp02xatkiv/files/0/c/7/dataset_0c74f579-c4bd-4eec-bdd5-2176ad08ff28.dat'  | samtools sort -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp02xatkiv/job_working_directory/000/73/outputs/dataset_d84c100d-1b22-4c61-8721-c026b0bbc7df.dat'

Exit Code:

```
0
```

Standard Error:

[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.19-r1273
[main] CMD: bwa index localref.fa
[main] Real time: 0.009 sec; CPU: 0.003 sec
[M::mem_pestat] analyzing insert size distribution for orientation FF...
[M::mem_pestat] (25, 50, 75) percentile: (286, 430, 628)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 1312)
[M::mem_pestat] mean and std.dev: (481.45, 272.75)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 1654)
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (230, 316, 407)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 761)
[M::mem_pestat] mean and std.dev: (322.54, 135.40)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 938)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation RR...
[M::mem_pestat] (25, 50, 75) percentile: (269, 449, 641)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 1385)
[M::mem_pestat] mean and std.dev: (485.65, 243.53)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 1757)
[M::mem_pestat] skip orientation FF
[M::mem_pestat] skip orientation RR
[M::mem_pestat] analyzing insert size distribution for orientation FF...
[M::mem_pestat] (25, 50, 75) percentile: (276, 431, 627)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 1329)
[M::mem_pestat] mean and std.dev: (463.06, 229.49)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 1680)
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (233, 317, 410)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 764)
[M::mem_pestat] mean and std.dev: (326.50, 135.84)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 941)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation RR...
[M::mem_pestat] (25, 50, 75) percentile: (292, 401, 616)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 1264)
[M::mem_pestat] mean and std.dev: (447.39, 203.33)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 1588)
[M::mem_pestat] skip orientation FF
[M::mem_pestat] skip orientation RR
[M::mem_pestat] analyzing insert size distribution for orientation FF...
[M::mem_pestat] (25, 50, 75) percentile: (243, 394, 540)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 1134)
[M::mem_pestat] mean and std.dev: (416.03, 216.45)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 1431)
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (234, 321, 417)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 783)
[M::mem_pestat] mean and std.dev: (329.38, 138.65)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 966)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation RR...
[M::mem_pestat] (25, 50, 75) percentile: (268, 427, 641)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 1387)
[M::mem_pestat] mean and std.dev: (458.84, 230.44)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 1760)
[M::mem_pestat] skip orientation FF
[M::mem_pestat] skip orientation RR
[M::mem_pestat] analyzing insert size distribution for orientation FF...
[M::mem_pestat] (25, 50, 75) percentile: (218, 327, 581)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 1307)
[M::mem_pestat] mean and std.dev: (406.87, 221.22)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 1670)
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (235, 324, 416)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 778)
[M::mem_pestat] mean and std.dev: (330.51, 136.51)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 959)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation RR...
[M::mem_pestat] (25, 50, 75) percentile: (276, 419, 604)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 1260)
[M::mem_pestat] mean and std.dev: (492.62, 289.15)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 1649)
[M::mem_pestat] skip orientation FF
[M::mem_pestat] skip orientation RR
[main] Version: 0.7.19-r1273
[main] CMD: bwa mem -t 1 -v 1 -R @RG\tID:SRR24839074\tSM:SRR24839074\tPL:ILLUMINA localref.fa /tmp/tmp02xatkiv/files/1/1/5/dataset_115745c3-506b-4717-8f86-3c0818350abc.dat /tmp/tmp02xatkiv/files/0/c/7/dataset_0c74f579-c4bd-4eec-bdd5-2176ad08ff28.dat
[main] Real time: 13.792 sec; CPU: 13.059 sec

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "illumina"}`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 2, "fastq_input1": {"values": [{"id": 9, "src": "dce"}]}, "fastq_input_selector": "paired_collection", "iset_stats": null}`
output_sort	`"coordinate"`
reference_source	`{"__current_case__": 1, "index_a": "auto", "ref_file": {"values": [{"id": 149, "src": "dce"}]}, "reference_source_selector": "history"}`
rg	`{"CN": null, "DS": null, "DT": null, "FO": null, "KS": null, "PG": null, "PI": null, "PL": "ILLUMINA", "PU": null, "__current_case__": 1, "read_group_id_conditional": {"__current_case__": 0, "do_auto_name": true}, "read_group_lb_conditional": {"LB": null, "__current_case__": 1, "do_auto_name": false}, "read_group_sm_conditional": {"__current_case__": 0, "do_auto_name": true}, "rg_selector": "set"}`

Job 2:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;  ln -s '/tmp/tmp02xatkiv/files/9/9/b/dataset_99b9aa3e-c21d-4b88-8526-9fe4da405b93.dat' 'localref.fa' && bwa index 'localref.fa' &&    bwa mem  -t "${GALAXY_SLOTS:-1}" -v 1                            -R '@RG\tID:SRR6674560\tSM:SRR6674560\tPL:ILLUMINA'   'localref.fa' '/tmp/tmp02xatkiv/files/7/7/f/dataset_77f6c98d-1dbb-4292-a624-9d565942d236.dat' '/tmp/tmp02xatkiv/files/e/2/f/dataset_e2fba24b-5bee-472d-826a-6bfe396f86f9.dat'  | samtools sort -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp02xatkiv/job_working_directory/000/74/outputs/dataset_1fd98e6d-c294-46cb-95aa-7fa4d16632b8.dat'

Exit Code:

```
0
```

Standard Error:

[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.19-r1273
[main] CMD: bwa index localref.fa
[main] Real time: 0.011 sec; CPU: 0.003 sec
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (203, 269, 368)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 698)
[M::mem_pestat] mean and std.dev: (288.35, 122.39)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 863)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (203, 273, 371)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 707)
[M::mem_pestat] mean and std.dev: (292.64, 125.15)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 875)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (203, 271, 369)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 701)
[M::mem_pestat] mean and std.dev: (288.53, 122.52)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 867)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (201, 271, 365)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 693)
[M::mem_pestat] mean and std.dev: (288.06, 122.27)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 857)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (205, 272, 375)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 715)
[M::mem_pestat] mean and std.dev: (292.45, 123.86)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 885)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (204, 275, 373)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 711)
[M::mem_pestat] mean and std.dev: (292.72, 125.06)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 880)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (207, 275, 375)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 711)
[M::mem_pestat] mean and std.dev: (293.71, 124.66)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 879)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (204, 275, 372)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 708)
[M::mem_pestat] mean and std.dev: (293.03, 125.45)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 876)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[main] Version: 0.7.19-r1273
[main] CMD: bwa mem -t 1 -v 1 -R @RG\tID:SRR6674560\tSM:SRR6674560\tPL:ILLUMINA localref.fa /tmp/tmp02xatkiv/files/7/7/f/dataset_77f6c98d-1dbb-4292-a624-9d565942d236.dat /tmp/tmp02xatkiv/files/e/2/f/dataset_e2fba24b-5bee-472d-826a-6bfe396f86f9.dat
[main] Real time: 29.092 sec; CPU: 28.047 sec

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "illumina"}`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 2, "fastq_input1": {"values": [{"id": 10, "src": "dce"}]}, "fastq_input_selector": "paired_collection", "iset_stats": null}`
output_sort	`"coordinate"`
reference_source	`{"__current_case__": 1, "index_a": "auto", "ref_file": {"values": [{"id": 150, "src": "dce"}]}, "reference_source_selector": "history"}`
rg	`{"CN": null, "DS": null, "DT": null, "FO": null, "KS": null, "PG": null, "PI": null, "PL": "ILLUMINA", "PU": null, "__current_case__": 1, "read_group_id_conditional": {"__current_case__": 0, "do_auto_name": true}, "read_group_lb_conditional": {"LB": null, "__current_case__": 1, "do_auto_name": false}, "read_group_sm_conditional": {"__current_case__": 0, "do_auto_name": true}, "rg_selector": "set"}`

Step 45: __FILTER_FAILED_DATASETS__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      input {"values": [{"id": 36, "src": "hdca"}]}
      
      replacement None

Step 46: toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp02xatkiv/files/d/8/4/dataset_d84c100d-1b22-4c61-8721-c026b0bbc7df.dat' infile && ln -s '/tmp/tmp02xatkiv/files/_metadata_files/0/6/3/metadata_063f225b-4b86-4514-a48d-8f0dd60afe1f.dat' infile.bai &&               samtools view -@ $addthreads -b  -q 20 -f 3 -F 0 -G 0   -o outfile      infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode	{"__current_case__": 1, "filter_config": {"cigarcons": null, "cond_expr": {"__current_case__": 0, "select_expr": "no"}, "cond_region": {"__current_case__": 0, "select_region": "no"}, "cond_rg": {"__current_case__": 0, "select_rg": "no"}, "exclusive_filter": null, "exclusive_filter_all": null, "inclusive_filter": ["1", "2"], "library": "", "qname_file": null, "quality": "20", "tag": ""}, "output_options": {"__current_case__": 0, "adv_output": {"collapsecigar": false, "readtags": []}, "complementary_output": false, "output_format": {"__current_case__": 2, "oformat": "bam"}, "reads_report_type": "retained"}, "outtype": "selected_reads", "subsample_config": {"subsampling_mode": {"__current_case__": 0, "factor": "1.0", "seed": null, "select_subsample": "fraction"}}}

Job 2:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp02xatkiv/files/1/f/d/dataset_1fd98e6d-c294-46cb-95aa-7fa4d16632b8.dat' infile && ln -s '/tmp/tmp02xatkiv/files/_metadata_files/8/b/b/metadata_8bb00aec-f164-409b-9fa5-b64b375e3c81.dat' infile.bai &&               samtools view -@ $addthreads -b  -q 20 -f 3 -F 0 -G 0   -o outfile      infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode	{"__current_case__": 1, "filter_config": {"cigarcons": null, "cond_expr": {"__current_case__": 0, "select_expr": "no"}, "cond_region": {"__current_case__": 0, "select_region": "no"}, "cond_rg": {"__current_case__": 0, "select_rg": "no"}, "exclusive_filter": null, "exclusive_filter_all": null, "inclusive_filter": ["1", "2"], "library": "", "qname_file": null, "quality": "20", "tag": ""}, "output_options": {"__current_case__": 0, "adv_output": {"collapsecigar": false, "readtags": []}, "complementary_output": false, "output_format": {"__current_case__": 2, "oformat": "bam"}, "reads_report_type": "retained"}, "outtype": "selected_reads", "subsample_config": {"subsampling_mode": {"__current_case__": 0, "factor": "1.0", "seed": null, "select_subsample": "fraction"}}}

Step 47: toolshed.g2.bx.psu.edu/repos/iuc/bamtools_split_ref/bamtools_split_ref/2.5.2+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp02xatkiv/files/1/6/a/dataset_16a6dc07-0ca7-45d2-81d4-15645cf1b995.dat' localbam.bam && ln -s '/tmp/tmp02xatkiv/files/_metadata_files/8/d/d/metadata_8ddc0aab-d780-4b79-aa87-e8ab071937dc.dat' 'localbam.bam.bai' && samtools view -bH localbam.bam --no-PG -o header.bam && bamtools split -reference -in localbam.bam -stub split_bam && (IFS=','; for i in $REFS_FROM_BAM_METADATA; do FN=`printf "split_bam.REF_%s.bam" "$i"`; if [ ! -f $FN ]; then cp header.bam "$FN"; fi; done) && cp '/tmp/tmp02xatkiv/job_working_directory/000/78/configs/tmpyyl7wpkl' galaxy.json

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
refs	`None`

Job 2:

Job state is ok

Command Line:

ln -s '/tmp/tmp02xatkiv/files/9/1/9/dataset_919c958e-6f2e-462f-8488-8e509e340aad.dat' localbam.bam && ln -s '/tmp/tmp02xatkiv/files/_metadata_files/c/e/2/metadata_ce280d26-b28a-4019-9763-1588bf9dece3.dat' 'localbam.bam.bai' && samtools view -bH localbam.bam --no-PG -o header.bam && bamtools split -reference -in localbam.bam -stub split_bam && (IFS=','; for i in $REFS_FROM_BAM_METADATA; do FN=`printf "split_bam.REF_%s.bam" "$i"`; if [ ! -f $FN ]; then cp header.bam "$FN"; fi; done) && cp '/tmp/tmp02xatkiv/job_working_directory/000/79/configs/tmpif9_2eoc' galaxy.json

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
refs	`None`

Step 48: toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export JAVA_OPTS="-Djava.awt.headless=true -Xmx${GALAXY_MEMORY_MB:-1024}m" &&    ln -s '/tmp/tmp02xatkiv/files/1/6/a/dataset_16a6dc07-0ca7-45d2-81d4-15645cf1b995.dat' 'SRR24839074' &&  qualimap bamqc -bam 'SRR24839074' -outdir results -outformat html --collect-overlap-pairs -nw 40 --paint-chromosome-limits -hm 3  -nt ${GALAXY_SLOTS:-1} &&   sed 's|images_qualimapReport/||g;s|css/||g' results/qualimapReport.html > '/tmp/tmp02xatkiv/job_working_directory/000/80/outputs/dataset_6b166eec-7597-454e-82d7-5756eb8d9e39.dat' && mkdir '/tmp/tmp02xatkiv/job_working_directory/000/80/outputs/dataset_6b166eec-7597-454e-82d7-5756eb8d9e39_files' && mv results/css/*.css '/tmp/tmp02xatkiv/job_working_directory/000/80/outputs/dataset_6b166eec-7597-454e-82d7-5756eb8d9e39_files' && mv results/css/*.png '/tmp/tmp02xatkiv/job_working_directory/000/80/outputs/dataset_6b166eec-7597-454e-82d7-5756eb8d9e39_files' && if [ -d results/images_qualimapReport ]; then mv results/images_qualimapReport/* '/tmp/tmp02xatkiv/job_working_directory/000/80/outputs/dataset_6b166eec-7597-454e-82d7-5756eb8d9e39_files' && for file in $(ls -A results/raw_data_qualimapReport); do mv "results/raw_data_qualimapReport/$file" `echo "results/$file" | sed 's/(//;s/)//'`; done fi && mv results/genome_results.txt results/summary_report.txt

Exit Code:

```
0
```

Standard Output:

Java memory size is set to 1200M
Launching application...

detected environment java options -Djava.awt.headless=true -Xmx1024m
QualiMap v.2.3
Built on 2023-05-19 16:57

Selected tool: bamqc
Available memory (Mb): 253
Max memory (Mb): 1037
Starting bam qc....
Loading sam header...
Loading locator...
Loading reference...
Number of windows: 40, effective number of windows: 41
Chunk of reads size: 1000
Number of threads: 1
Total processed windows:41
Number of reads: 32899
Number of valid reads: 34468
Number of correct strand reads:0

Inside of regions...
Num mapped reads: 32899
Num mapped first of pair: 16452
Num mapped second of pair: 16447
Num singletons: 0
Time taken to analyze reads: 2
Computing descriptors...
numberOfMappedBases: 7467478
referenceSize: 3205
numberOfSequencedBases: 7467126
numberOfAs: 2138407
Computing per chromosome statistics...
Computing histograms...
Overall analysis time: 2
end of bam qc
Computing report...
Writing HTML report...
HTML report created successfully

Finished

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
duplicate_skipping	`None`
per_base_coverage	`false`
plot_specific	`{"genome_gc_distr": null, "homopolymer_size": "3", "n_bins": "40", "paint_chromosome_limits": true}`
stats_regions	`{"__current_case__": 0, "region_select": "all"}`

Job 2:

Job state is ok

Command Line:

export JAVA_OPTS="-Djava.awt.headless=true -Xmx${GALAXY_MEMORY_MB:-1024}m" &&    ln -s '/tmp/tmp02xatkiv/files/9/1/9/dataset_919c958e-6f2e-462f-8488-8e509e340aad.dat' 'SRR6674560' &&  qualimap bamqc -bam 'SRR6674560' -outdir results -outformat html --collect-overlap-pairs -nw 40 --paint-chromosome-limits -hm 3  -nt ${GALAXY_SLOTS:-1} &&   sed 's|images_qualimapReport/||g;s|css/||g' results/qualimapReport.html > '/tmp/tmp02xatkiv/job_working_directory/000/81/outputs/dataset_7eef9380-4ad0-4de6-995f-0e493ba54bdd.dat' && mkdir '/tmp/tmp02xatkiv/job_working_directory/000/81/outputs/dataset_7eef9380-4ad0-4de6-995f-0e493ba54bdd_files' && mv results/css/*.css '/tmp/tmp02xatkiv/job_working_directory/000/81/outputs/dataset_7eef9380-4ad0-4de6-995f-0e493ba54bdd_files' && mv results/css/*.png '/tmp/tmp02xatkiv/job_working_directory/000/81/outputs/dataset_7eef9380-4ad0-4de6-995f-0e493ba54bdd_files' && if [ -d results/images_qualimapReport ]; then mv results/images_qualimapReport/* '/tmp/tmp02xatkiv/job_working_directory/000/81/outputs/dataset_7eef9380-4ad0-4de6-995f-0e493ba54bdd_files' && for file in $(ls -A results/raw_data_qualimapReport); do mv "results/raw_data_qualimapReport/$file" `echo "results/$file" | sed 's/(//;s/)//'`; done fi && mv results/genome_results.txt results/summary_report.txt

Exit Code:

```
0
```

Standard Output:

Java memory size is set to 1200M
Launching application...

detected environment java options -Djava.awt.headless=true -Xmx1024m
QualiMap v.2.3
Built on 2023-05-19 16:57

Selected tool: bamqc
Available memory (Mb): 253
Max memory (Mb): 1037
Starting bam qc....
Loading sam header...
Loading locator...
Loading reference...
Number of windows: 40, effective number of windows: 41
Chunk of reads size: 1000
Number of threads: 1
Total processed windows:41
Number of reads: 94605
Number of valid reads: 94662
Number of correct strand reads:0

Inside of regions...
Num mapped reads: 94605
Num mapped first of pair: 47303
Num mapped second of pair: 47302
Num singletons: 0
Time taken to analyze reads: 4
Computing descriptors...
numberOfMappedBases: 20870163
referenceSize: 3111
numberOfSequencedBases: 20869480
numberOfAs: 6037683
Computing per chromosome statistics...
Computing histograms...
Overall analysis time: 4
end of bam qc
Computing report...
Writing HTML report...
HTML report created successfully

Finished

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
duplicate_skipping	`None`
per_base_coverage	`false`
plot_specific	`{"genome_gc_distr": null, "homopolymer_size": "3", "n_bins": "40", "paint_chromosome_limits": true}`
stats_regions	`{"__current_case__": 0, "region_select": "all"}`

Step 49: __APPLY_RULES__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
input	`{"values": [{"id": 39, "src": "hdca"}]}`
rules	`{"mapping": [{"columns": [1, 0], "editing": false, "type": "list_identifiers"}], "rules": [{"error": null, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"error": null, "type": "add_column_metadata", "value": "identifier1", "warn": null}]}`

Step 50: toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mv '/tmp/tmp02xatkiv/job_working_directory/000/83/configs/tmpfyqdv22g' '/tmp/tmp02xatkiv/job_working_directory/000/83/outputs/dataset_78515f26-91e4-4f2c-8c68-4a0fb96948cd.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_collection	`{"values": [{"id": 193, "src": "dce"}]}`

Job 2:

Job state is ok

Command Line:

mv '/tmp/tmp02xatkiv/job_working_directory/000/84/configs/tmp7jpjmocf' '/tmp/tmp02xatkiv/job_working_directory/000/84/outputs/dataset_d259752d-5f4b-48fb-8869-db519ce365da.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_collection	`{"values": [{"id": 196, "src": "dce"}]}`

Step 6: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.26.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -sf '/tmp/tmp02xatkiv/files/c/4/e/dataset_c4ee9c9a-53fd-4899-aa2b-cfdc612d6ef4.dat' 'SRR24839074.fastqsanger.gz' && ln -sf '/tmp/tmp02xatkiv/files/2/d/b/dataset_2dbfcdc2-fd52-4ae2-92d5-6bf8e7ec0ff1.dat' 'SRR24839074_R2.fastqsanger.gz' &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR24839074.fastqsanger.gz'  -i 'SRR24839074.fastqsanger.gz'   -I 'SRR24839074_R2.fastqsanger.gz' -o first.fastqsanger.gz -O second.fastqsanger.gz      --detect_adapter_for_pe                      -l 30                  -5  -3  -M 30     && mv first.fastqsanger.gz '/tmp/tmp02xatkiv/job_working_directory/000/10/outputs/dataset_115745c3-506b-4717-8f86-3c0818350abc.dat' && mv second.fastqsanger.gz '/tmp/tmp02xatkiv/job_working_directory/000/10/outputs/dataset_0c74f579-c4bd-4eec-bdd5-2176ad08ff28.dat'

Exit Code:

```
0
```

Standard Error:

Detecting adapter sequence for read1...
No adapter detected for read1

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 83824
total bases: 19492614
Q20 bases: 19018847(97.5695%)
Q30 bases: 18842970(96.6672%)

Read2 before filtering:
total reads: 83824
total bases: 19502260
Q20 bases: 17970794(92.1472%)
Q30 bases: 17482952(89.6458%)

Read1 after filtering:
total reads: 83550
total bases: 19334297
Q20 bases: 18913500(97.8236%)
Q30 bases: 18760119(97.0303%)

Read2 after filtering:
total reads: 83550
total bases: 18879169
Q20 bases: 17666850(93.5785%)
Q30 bases: 17295733(91.6128%)

Filtering result:
reads passed filter: 167100
reads failed due to low quality: 52
reads failed due to too many N: 4
reads failed due to too short: 492
reads with adapter trimmed: 1486
bases trimmed due to adapters: 5745

Duplication rate: 6.3693%

Insert size peak (evaluated by paired-end reads): 308

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for SRR24839074.fastqsanger.gz -i SRR24839074.fastqsanger.gz -I SRR24839074_R2.fastqsanger.gz -o first.fastqsanger.gz -O second.fastqsanger.gz --detect_adapter_for_pe -l 30 -5 -3 -M 30 
fastp v0.26.0, time used: 64 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": "30"}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": false}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": true, "cut_by_quality5": true, "cut_mean_quality": "30", "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 1, "adapter_trimming_options": {"adapter_sequence1": "", "adapter_sequence2": "", "detect_adapter_for_pe": true, "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_front2": null, "trim_tail1": null, "trim_tail2": null}, "merge_reads": {"__current_case__": 1, "merge": ""}, "paired_input": {"values": [{"id": 3, "src": "dce"}]}, "single_paired_selector": "paired_collection"}`

Job 2:

Job state is ok

Command Line:

ln -sf '/tmp/tmp02xatkiv/files/d/c/1/dataset_dc112382-bfdc-47c3-9332-29457ca6e2aa.dat' 'SRR6674560.fastqsanger.gz' && ln -sf '/tmp/tmp02xatkiv/files/7/1/3/dataset_713cfb5d-14f5-4cc1-b4b6-e279f63b40ec.dat' 'SRR6674560_R2.fastqsanger.gz' &&   fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR6674560.fastqsanger.gz'  -i 'SRR6674560.fastqsanger.gz'   -I 'SRR6674560_R2.fastqsanger.gz' -o first.fastqsanger.gz -O second.fastqsanger.gz      --detect_adapter_for_pe                      -l 30                  -5  -3  -M 30     && mv first.fastqsanger.gz '/tmp/tmp02xatkiv/job_working_directory/000/11/outputs/dataset_77f6c98d-1dbb-4292-a624-9d565942d236.dat' && mv second.fastqsanger.gz '/tmp/tmp02xatkiv/job_working_directory/000/11/outputs/dataset_e2fba24b-5bee-472d-826a-6bfe396f86f9.dat'

Exit Code:

```
0
```

Standard Error:

Detecting adapter sequence for read1...
>I7_Nextera_Transposase_1 | >Trans2_rc | >I7_Nextera_Transposase_1 | >Trans2_rc
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

Detecting adapter sequence for read2...
>I5_Nextera_Transposase_1 | >Trans1_rc | >I5_Nextera_Transposase_1 | >Trans1_rc
CTGTCTCTTATACACATCTGACGCTGCCGACGA

Read1 before filtering:
total reads: 172633
total bases: 43330883
Q20 bases: 41651419(96.1241%)
Q30 bases: 41087119(94.8218%)

Read2 before filtering:
total reads: 172633
total bases: 43330883
Q20 bases: 40409850(93.2588%)
Q30 bases: 39428880(90.9949%)

Read1 after filtering:
total reads: 172415
total bases: 38387717
Q20 bases: 37778679(98.4135%)
Q30 bases: 37551301(97.8211%)

Read2 after filtering:
total reads: 172415
total bases: 38106570
Q20 bases: 37042825(97.2085%)
Q30 bases: 36668901(96.2272%)

Filtering result:
reads passed filter: 344830
reads failed due to low quality: 40
reads failed due to too many N: 0
reads failed due to too short: 396
reads with adapter trimmed: 138457
bases trimmed due to adapters: 6455966

Duplication rate: 7.68799%

Insert size peak (evaluated by paired-end reads): 251

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for SRR6674560.fastqsanger.gz -i SRR6674560.fastqsanger.gz -I SRR6674560_R2.fastqsanger.gz -o first.fastqsanger.gz -O second.fastqsanger.gz --detect_adapter_for_pe -l 30 -5 -3 -M 30 
fastp v0.26.0, time used: 14 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": "30"}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": false}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": true, "cut_by_quality5": true, "cut_mean_quality": "30", "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 1, "adapter_trimming_options": {"adapter_sequence1": "", "adapter_sequence2": "", "detect_adapter_for_pe": true, "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_front2": null, "trim_tail1": null, "trim_tail2": null}, "merge_reads": {"__current_case__": 1, "merge": ""}, "paired_input": {"values": [{"id": 6, "src": "dce"}]}, "single_paired_selector": "paired_collection"}`

Step 51: toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mv '/tmp/tmp02xatkiv/job_working_directory/000/85/configs/tmpbuggwsau' '/tmp/tmp02xatkiv/job_working_directory/000/85/outputs/dataset_4d4afa8e-4c3f-4a07-b308-d484155c5d2c.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_collection	`{"values": [{"id": 43, "src": "hdca"}]}`

Step 52: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/86/outputs/dataset_4392ad74-684b-4b44-aec2-afcb2aa244d7.dat' -g    -r '^(Final read mapping results: (.+))$' '$1\t$2' '/tmp/tmp02xatkiv/files/4/d/4/dataset_4d4afa8e-4c3f-4a07-b308-d484155c5d2c.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "^(Final read mapping results: (.+))$", "global": true, "is_regex": true, "replace_pattern": "$1\\t$2", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 53: __RELABEL_FROM_FILE__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
how	`{"__current_case__": 1, "how_select": "tabular", "labels": {"values": [{"id": 165, "src": "hda"}]}, "strict": false}`
input	`{"values": [{"id": 42, "src": "hdca"}]}`

Step 54: __APPLY_RULES__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
input	`{"values": [{"id": 44, "src": "hdca"}]}`
rules	`{"mapping": [{"columns": [1, 0], "editing": false, "type": "list_identifiers"}], "rules": [{"error": null, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"error": null, "type": "add_column_metadata", "value": "identifier1", "warn": null}]}`

Step 55: toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mv '/tmp/tmp02xatkiv/job_working_directory/000/89/configs/tmpyt9nuida' '/tmp/tmp02xatkiv/job_working_directory/000/89/outputs/dataset_b50962cd-c28e-43db-a173-ad9c5ce8f034.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_collection	`{"values": [{"id": 205, "src": "dce"}]}`

Job 2:

Job state is ok

Command Line:

mv '/tmp/tmp02xatkiv/job_working_directory/000/90/configs/tmpjdqjslji' '/tmp/tmp02xatkiv/job_working_directory/000/90/outputs/dataset_b74b10e5-6265-48d2-b945-2bf65e7fa729.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_collection	`{"values": [{"id": 206, "src": "dce"}]}`

Step 56: toolshed.g2.bx.psu.edu/repos/iuc/ivar_consensus/ivar_consensus/1.4.4+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp02xatkiv/files/3/f/f/dataset_3ff3fc70-d3ce-4b9f-b213-a363bd2a7a83.dat' sorted.bam && samtools mpileup -A -a -d 0 -Q 0 sorted.bam | ivar consensus -p consensus -q 20 -t 0.7 -c 0.8 -m 10 -n N && sed -i "s|consensus|HA|" consensus.fa

Exit Code:

```
0
```

Standard Error:

[mpileup] 1 samples in 1 input files
[mpileup] Max depth set to maximum value (2147483647)

Standard Output:

Minimum Quality: 20
Threshold: 0.7
Minimum depth: 10
Minimum Insert Threshold: 0.8
Regions with depth less than minimum depth covered by: N
Reference length: 1751
Positions with 0 depth: 0
Positions with depth below 10: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
depth_action	`"-n N"`
min_depth	`"10"`
min_freq	`"0.7"`
min_indel_freq	`"0.8"`
min_qual	`"20"`

Job 2:

Job state is ok

Command Line:

ln -s '/tmp/tmp02xatkiv/files/b/5/7/dataset_b57ae436-48a7-44c5-9f39-7e5c938398f9.dat' sorted.bam && samtools mpileup -A -a -d 0 -Q 0 sorted.bam | ivar consensus -p consensus -q 20 -t 0.7 -c 0.8 -m 10 -n N && sed -i "s|consensus|NA|" consensus.fa

Exit Code:

```
0
```

Standard Error:

[mpileup] 1 samples in 1 input files
[mpileup] Max depth set to maximum value (2147483647)

Standard Output:

Minimum Quality: 20
Threshold: 0.7
Minimum depth: 10
Minimum Insert Threshold: 0.8
Regions with depth less than minimum depth covered by: N
Reference length: 1454
Positions with 0 depth: 0
Positions with depth below 10: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
depth_action	`"-n N"`
min_depth	`"10"`
min_freq	`"0.7"`
min_indel_freq	`"0.8"`
min_qual	`"20"`

Job 3:

Job state is ok

Command Line:

ln -s '/tmp/tmp02xatkiv/files/e/9/1/dataset_e913e7fe-4450-40c0-a0de-d2fb55a2b605.dat' sorted.bam && samtools mpileup -A -a -d 0 -Q 0 sorted.bam | ivar consensus -p consensus -q 20 -t 0.7 -c 0.8 -m 10 -n N && sed -i "s|consensus|HA|" consensus.fa

Exit Code:

```
0
```

Standard Error:

[mpileup] 1 samples in 1 input files
[mpileup] Max depth set to maximum value (2147483647)

Standard Output:

Minimum Quality: 20
Threshold: 0.7
Minimum depth: 10
Minimum Insert Threshold: 0.8
Regions with depth less than minimum depth covered by: N
Reference length: 1701
Positions with 0 depth: 0
Positions with depth below 10: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
depth_action	`"-n N"`
min_depth	`"10"`
min_freq	`"0.7"`
min_indel_freq	`"0.8"`
min_qual	`"20"`

Job 4:

Job state is ok

Command Line:

ln -s '/tmp/tmp02xatkiv/files/6/2/1/dataset_621041ee-f21f-44bc-85b3-cfaf7a3c9866.dat' sorted.bam && samtools mpileup -A -a -d 0 -Q 0 sorted.bam | ivar consensus -p consensus -q 20 -t 0.7 -c 0.8 -m 10 -n N && sed -i "s|consensus|NA|" consensus.fa

Exit Code:

```
0
```

Standard Error:

[mpileup] 1 samples in 1 input files
[mpileup] Max depth set to maximum value (2147483647)

Standard Output:

Minimum Quality: 20
Threshold: 0.7
Minimum depth: 10
Minimum Insert Threshold: 0.8
Regions with depth less than minimum depth covered by: N
Reference length: 1410
Positions with 0 depth: 0
Positions with depth below 10: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
depth_action	`"-n N"`
min_depth	`"10"`
min_freq	`"0.7"`
min_indel_freq	`"0.8"`
min_qual	`"20"`

Step 57: wc_gnu:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp02xatkiv/files/b/5/0/dataset_b50962cd-c28e-43db-a173-ad9c5ce8f034.dat' | wc -l | awk '{ print $1 }' >> /tmp/tmp02xatkiv/job_working_directory/000/95/outputs/dataset_bc481323-8dc1-42e1-8e31-ad8cfbea10b6.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
include_header	`false`
options	`["lines"]`

Job 2:

Job state is ok

Command Line:

cat '/tmp/tmp02xatkiv/files/b/7/4/dataset_b74b10e5-6265-48d2-b945-2bf65e7fa729.dat' | wc -l | awk '{ print $1 }' >> /tmp/tmp02xatkiv/job_working_directory/000/96/outputs/dataset_b0028995-abe9-44f6-8d01-3d73f4371314.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
include_header	`false`
options	`["lines"]`

Step 58: __APPLY_RULES__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
input	`{"values": [{"id": 47, "src": "hdca"}]}`
rules	`{"mapping": [{"columns": [1, 0], "editing": false, "type": "list_identifiers"}], "rules": [{"error": null, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"error": null, "type": "add_column_metadata", "value": "identifier1", "warn": null}]}`

Step 59: toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

(   awk '{print "HA\t"$0} END { if (NR == 0 && NF == 0) { print "HA\t" } }' "/tmp/tmp02xatkiv/files/b/c/4/dataset_bc481323-8dc1-42e1-8e31-ad8cfbea10b6.dat";   awk '{print "NA\t"$0} END { if (NR == 0 && NF == 0) { print "NA\t" } }' "/tmp/tmp02xatkiv/files/b/0/0/dataset_b0028995-abe9-44f6-8d01-3d73f4371314.dat";   ) > /tmp/tmp02xatkiv/job_working_directory/000/97/outputs/dataset_ec5a62b7-0196-4ec5-93fe-a1ec856520df.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filename	`{"__current_case__": 0, "add_name": true, "place_name": "same_multiple"}`
one_header	`false`

Step 60: toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

(   printf "SRR24839074\t"; awk '{ print $0 } END { if (NR == 0 && NF == 0) { print "" } }' "/tmp/tmp02xatkiv/files/4/5/7/dataset_457eec54-3174-4109-ac57-05b15059b2a2.dat";   printf "SRR6674560\t"; awk '{ print $0 } END { if (NR == 0 && NF == 0) { print "" } }' "/tmp/tmp02xatkiv/files/8/1/b/dataset_81b59083-8a5e-42a4-ba16-81fd98a02a59.dat";   ) > /tmp/tmp02xatkiv/job_working_directory/000/103/outputs/dataset_508317e8-6322-4def-ac79-73b61481e81e.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filename	`{"__current_case__": 0, "add_name": true, "place_name": "same_once"}`
one_header	`false`

Job 2:

Job state is ok

Command Line:

(   printf "SRR24839074\t"; awk '{ print $0 } END { if (NR == 0 && NF == 0) { print "" } }' "/tmp/tmp02xatkiv/files/5/0/2/dataset_502f4fa5-2619-4a14-a8f8-4abd6a7fc8e8.dat";   printf "SRR6674560\t"; awk '{ print $0 } END { if (NR == 0 && NF == 0) { print "" } }' "/tmp/tmp02xatkiv/files/9/6/8/dataset_96854057-b709-41c5-827c-2516ebec475f.dat";   ) > /tmp/tmp02xatkiv/job_working_directory/000/104/outputs/dataset_58a4154d-07fd-4ae0-a9e9-71b4b4fcea98.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filename	`{"__current_case__": 0, "add_name": true, "place_name": "same_once"}`
one_header	`false`

Step 7: wc_gnu:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp02xatkiv/files/d/5/8/dataset_d58804ea-ae25-4405-b7c0-ca80850c48b2.dat' | wc -l | awk '{ print $1 }' >> /tmp/tmp02xatkiv/job_working_directory/000/12/outputs/dataset_6ba5f3c9-7c60-4f0d-9605-eb75f08bcad4.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
include_header	`false`
options	`["lines"]`

Step 61: Filter1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp02xatkiv/galaxy-dev/tools/stats/filtering.py' '/tmp/tmp02xatkiv/files/e/c/5/dataset_ec5a62b7-0196-4ec5-93fe-a1ec856520df.dat' '/tmp/tmp02xatkiv/job_working_directory/000/98/outputs/dataset_46914e2a-4243-419c-af06-a8f7133594ac.dat' '/tmp/tmp02xatkiv/job_working_directory/000/98/configs/tmpgwb1id95' 2 "float,int" 0

Exit Code:

```
0
```

Standard Output:

Filtering with c2 > 1, 
kept 100.00% of 2 valid lines (2 total lines).

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
cond	`"c2 > 1"`
dbkey	`"?"`
header_lines	`"0"`

Step 62: Filter1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp02xatkiv/galaxy-dev/tools/stats/filtering.py' '/tmp/tmp02xatkiv/files/e/c/5/dataset_ec5a62b7-0196-4ec5-93fe-a1ec856520df.dat' '/tmp/tmp02xatkiv/job_working_directory/000/99/outputs/dataset_0047bb9d-54f1-4110-9938-4e016e3b16c0.dat' '/tmp/tmp02xatkiv/job_working_directory/000/99/configs/tmp0h9m_q0q' 2 "float,int" 0

Exit Code:

```
0
```

Standard Output:

Filtering with c2 > 2, 
kept 0.00% of 2 valid lines (2 total lines).

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
cond	`"c2 > 2"`
dbkey	`"?"`
header_lines	`"0"`

Step 63: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.5+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/105/outputs/dataset_4333ae90-46ad-4756-b038-574a6889d83c.dat'     -r '^(.+)\t>Consensus_(.+)_threshold.+' '>$1|$2' '/tmp/tmp02xatkiv/files/5/0/8/dataset_508317e8-6322-4def-ac79-73b61481e81e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	` [{"index": 0, "caseinsensitive": false, "find_pattern": "^(.+)\t>Consensus_(.+)_threshold.+", "global": false, "is_regex": true, "replace_pattern": ">$1

Job 2:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/c41d78ae5fee/text_processing/find_and_replace' -o '/tmp/tmp02xatkiv/job_working_directory/000/106/outputs/dataset_9229fbd9-6ba0-4ee4-8c87-ec6a55d1dff5.dat'     -r '^(.+)\t>Consensus_(.+)_threshold.+' '>$1|$2' '/tmp/tmp02xatkiv/files/5/8/a/dataset_58a4154d-07fd-4ae0-a9e9-71b4b4fcea98.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	` [{"index": 0, "caseinsensitive": false, "find_pattern": "^(.+)\t>Consensus_(.+)_threshold.+", "global": false, "is_regex": true, "replace_pattern": ">$1

Step 64: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp02xatkiv/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp02xatkiv/files/4/6/9/dataset_46914e2a-4243-419c-af06-a8f7133594ac.dat' 'c1' T '/tmp/tmp02xatkiv/job_working_directory/000/100/outputs/dataset_900f1597-a3c5-49c3-8cdc-b4e12f744505.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c1"`
dbkey	`"?"`
delimiter	`"T"`

Step 65: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmp02xatkiv/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp02xatkiv/files/0/0/4/dataset_0047bb9d-54f1-4110-9938-4e016e3b16c0.dat' 'c1' T '/tmp/tmp02xatkiv/job_working_directory/000/101/outputs/dataset_21944bce-797d-4524-9626-eb808cfcb1fc.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c1"`
dbkey	`"?"`
delimiter	`"T"`

Step 66: __FILTER_FROM_FILE__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
how	`{"__current_case__": 0, "filter_source": {"values": [{"id": 181, "src": "hda"}]}, "how_filter": "remove_if_absent"}`
input	`{"values": [{"id": 51, "src": "hdca"}]}`

Step 67: toolshed.g2.bx.psu.edu/repos/rnateam/mafft/rbc_mafft/7.526+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

bash inputs.sh &&     mafft-fftns  --nuc  --kimura 200        --thread ${GALAXY_SLOTS:-1} --threadit 0  input.fa > '/tmp/tmp02xatkiv/job_working_directory/000/108/outputs/dataset_4c783c3f-3d3d-4edc-b088-061070cf4757.dat'

Exit Code:

```
0
```

Standard Error:

nthread = 1
nthreadpair = 1
nthreadtb = 1
jtt/kimura 200
ppenalty_ex = 0
stacksize: 16384 kb
generating a scoring matrix for nucleotide (dist=200) ... done
Gap Penalty = -1.53, +0.00, +0.00



Making a distance matrix ..

    1 / 2 (thread    0)
done.

Constructing a UPGMA tree (efffree=1) ... 

    0 / 2
done.

Progressive alignment 1/1... 

STEP     1 / 1 (thread    0) f��
done.

disttbfast (nuc) Version 7.526
alg=A, model=DNA200 (2), 1.53 (4.59), -0.00 (-0.00), noshift, amax=0.0
1 thread(s)


Strategy:
 FFT-NS-1 (Very fast but very rough)
 Progressive method (rough guide tree was used.)

If unsure which option to use, try 'mafft --auto input > output'.
For more information, see 'mafft --help', 'mafft --man' and the mafft page.

The default gap scoring scheme has been changed in version 7.110 (2013 Oct).
It tends to insert more gaps into gap-rich regions than previous versions.
To disable this change, add the --leavegappyregion option.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
anysymbol	`false`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
datatype_selection	`{"__current_case__": 1, "datatype": "--nuc", "fmodel": false, "gap_costs": {"__current_case__": 0, "use_defaults": "yes"}, "scoring_matrix": {"__current_case__": 0, "coefficient": "200", "type": "--kimura"}}`
dbkey	`"?"`
flavour	`{"__current_case__": 2, "type": "mafft-fftns"}`
input	`{"__current_case__": 0, "batches": [{"__index__": 0, "inputs": {"values": [{"id": 233, "src": "dce"}]}}], "mapping": "implicit"}`
outputFormat	`""`
reorder	`false`
treeout	`false`

Job 2:

Job state is ok

Command Line:

bash inputs.sh &&     mafft-fftns  --nuc  --kimura 200        --thread ${GALAXY_SLOTS:-1} --threadit 0  input.fa > '/tmp/tmp02xatkiv/job_working_directory/000/109/outputs/dataset_25234b50-c690-444b-ab5e-067e6e6b4c4f.dat'

Exit Code:

```
0
```

Standard Error:

nthread = 1
nthreadpair = 1
nthreadtb = 1
jtt/kimura 200
ppenalty_ex = 0
stacksize: 16384 kb
generating a scoring matrix for nucleotide (dist=200) ... done
Gap Penalty = -1.53, +0.00, +0.00



Making a distance matrix ..

    1 / 2 (thread    0)
done.

Constructing a UPGMA tree (efffree=1) ... 

    0 / 2
done.

Progressive alignment 1/1... 

STEP     1 / 1 (thread    0) f��
done.

disttbfast (nuc) Version 7.526
alg=A, model=DNA200 (2), 1.53 (4.59), -0.00 (-0.00), noshift, amax=0.0
1 thread(s)


Strategy:
 FFT-NS-1 (Very fast but very rough)
 Progressive method (rough guide tree was used.)

If unsure which option to use, try 'mafft --auto input > output'.
For more information, see 'mafft --help', 'mafft --man' and the mafft page.

The default gap scoring scheme has been changed in version 7.110 (2013 Oct).
It tends to insert more gaps into gap-rich regions than previous versions.
To disable this change, add the --leavegappyregion option.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
anysymbol	`false`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
datatype_selection	`{"__current_case__": 1, "datatype": "--nuc", "fmodel": false, "gap_costs": {"__current_case__": 0, "use_defaults": "yes"}, "scoring_matrix": {"__current_case__": 0, "coefficient": "200", "type": "--kimura"}}`
dbkey	`"?"`
flavour	`{"__current_case__": 2, "type": "mafft-fftns"}`
input	`{"__current_case__": 0, "batches": [{"__index__": 0, "inputs": {"values": [{"id": 234, "src": "dce"}]}}], "mapping": "implicit"}`
outputFormat	`""`
reorder	`false`
treeout	`false`

Step 68: __FILTER_FROM_FILE__:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
how	`{"__current_case__": 0, "filter_source": {"values": [{"id": 182, "src": "hda"}]}, "how_filter": "remove_if_absent"}`
input	`{"values": [{"id": 54, "src": "hdca"}]}`

Step 69: toolshed.g2.bx.psu.edu/repos/iuc/snipit/snipit/1.6+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

snipit '/tmp/tmp02xatkiv/files/4/c/7/dataset_4c783c3f-3d3d-4edc-b088-061070cf4757.dat' --sequence-type nt -c classic  --ambig-mode snps  -f png --solid-background    --sort-by-mutation-number

Exit Code:

```
0
```

Standard Output:

�[32mNote:�[0m assuming the alignment provided is of type nt. If this is not the case, change input --sequence-type
�[32mSnipping Complete: /tmp/tmp02xatkiv/job_working_directory/000/110/working/snp_plot.png�[0m

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
dims	`{"height": "0.0", "size_option": "", "width": "0.0"}`
mode	`{"__current_case__": 0, "colouring": {"__current_case__": 1, "palette": "classic"}, "ref": {"__current_case__": 0, "select": "first"}, "sequence_type": "nt"}`
plot	`{"__current_case__": 2, "format": "png", "transparent_background": false}`
pos_restrict	`{"ambig_mode": "snps", "exclude_positions": [], "include_positions": [], "show_indels": false}`
style	`{"flip_vertical": false, "labels": {"__current_case__": 0, "choose": ""}, "position_labels": true, "sort": {"__current_case__": 2, "high_to_low": false, "order": "--sort-by-mutation-number"}}`
write_snps	`false`

Job 2:

Job state is ok

Command Line:

snipit '/tmp/tmp02xatkiv/files/2/5/2/dataset_25234b50-c690-444b-ab5e-067e6e6b4c4f.dat' --sequence-type nt -c classic  --ambig-mode snps  -f png --solid-background    --sort-by-mutation-number

Exit Code:

```
0
```

Standard Output:

�[32mNote:�[0m assuming the alignment provided is of type nt. If this is not the case, change input --sequence-type
�[32mSnipping Complete: /tmp/tmp02xatkiv/job_working_directory/000/111/working/snp_plot.png�[0m

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
dims	`{"height": "0.0", "size_option": "", "width": "0.0"}`
mode	`{"__current_case__": 0, "colouring": {"__current_case__": 1, "palette": "classic"}, "ref": {"__current_case__": 0, "select": "first"}, "sequence_type": "nt"}`
plot	`{"__current_case__": 2, "format": "png", "transparent_background": false}`
pos_restrict	`{"ambig_mode": "snps", "exclude_positions": [], "include_positions": [], "show_indels": false}`
style	`{"flip_vertical": false, "labels": {"__current_case__": 0, "choose": ""}, "position_labels": true, "sort": {"__current_case__": 2, "high_to_low": false, "order": "--sort-by-mutation-number"}}`
write_snps	`false`

Step 70: Unlabelled step:
- step_state: scheduled

Step 8: wc_gnu:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp02xatkiv/files/1/1/f/dataset_11f11b2a-76b4-4223-9d67-91cf3d4b8b5f.dat' | wc -l | awk '{ print $1 }' >> /tmp/tmp02xatkiv/job_working_directory/000/13/outputs/dataset_4b76d498-1e68-4a4f-b6a4-220538ea24d0.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
include_header	`false`
options	`["lines"]`

Step 9: __UNZIP_COLLECTION__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      input {"values": [{"id": 9, "src": "dce"}]}
  - Job 2:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "aa32f52e4a7c11f0bb096045bd4a41c6"
      
      input {"values": [{"id": 10, "src": "dce"}]}

Step 10: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"aa32f52e4a7c11f0bb096045bd4a41c6"`
chromInfo	`"/tmp/tmp02xatkiv/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Other invocation details
- history_id
  - 9470b90135fa7a95
- history_state
  - ok
- invocation_id
  - 9470b90135fa7a95
- invocation_state
  - scheduled
- workflow_id
  - 9470b90135fa7a95

gxydevbot force-pushed the workflows/virology/influenza-isolates-consensus-and-subtyping branch from d383a8e to 0665c32 Compare June 9, 2025 07:04

gxydevbot changed the title ~~Updating workflows/virology/influenza-isolates-consensus-and-subtyping from 0.2 to 0.3~~ Updating workflows/virology/influenza-isolates-consensus-and-subtyping from 0.2 to 0.3 Jun 9, 2025

Updating workflows/virology/influenza-isolates-consensus-and-subtypin…

7b24a48

…g from 0.2 to 0.3

gxydevbot force-pushed the workflows/virology/influenza-isolates-consensus-and-subtyping branch from 0665c32 to 7b24a48 Compare June 16, 2025 06:26

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Uh oh!

Updating workflows/virology/influenza-isolates-consensus-and-subtyping from 0.2 to 0.3 #863

Updating workflows/virology/influenza-isolates-consensus-and-subtyping from 0.2 to 0.3 #863

Uh oh!

gxydevbot commented May 19, 2025

Uh oh!

gxydevbot commented Jun 9, 2025

Uh oh!

gxydevbot commented Jun 16, 2025

Uh oh!

github-actions bot commented Jun 16, 2025

Workflow invocation details

Uh oh!

Uh oh!

Updating workflows/virology/influenza-isolates-consensus-and-subtyping from 0.2 to 0.3 #863

Are you sure you want to change the base?

Updating workflows/virology/influenza-isolates-consensus-and-subtyping from 0.2 to 0.3 #863

Uh oh!

Conversation

gxydevbot commented May 19, 2025

Uh oh!

gxydevbot commented Jun 9, 2025

Uh oh!

gxydevbot commented Jun 16, 2025

Uh oh!

github-actions bot commented Jun 16, 2025

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

Uh oh!