Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Reducing picking.py to be simpler, more focused, and more performant. #75

Merged
merged 7 commits into from
Nov 11, 2024

Conversation

tfenne
Copy link
Member

@tfenne tfenne commented Oct 24, 2024

Closes #38

@tfenne
Copy link
Member Author

tfenne commented Oct 24, 2024

I'm still actively working on this - mostly writing tests and fixing up documentation.

Copy link

codecov bot commented Oct 24, 2024

Codecov Report

All modified and coverable lines are covered by tests ✅

Project coverage is 96.63%. Comparing base (e9ddc8d) to head (9addfdc).
Report is 1 commits behind head on main.

Additional details and impacted files
@@            Coverage Diff             @@
##             main      #75      +/-   ##
==========================================
- Coverage   96.74%   96.63%   -0.11%     
==========================================
  Files          26       26              
  Lines        1751     1696      -55     
  Branches      333      330       -3     
==========================================
- Hits         1694     1639      -55     
  Misses         31       31              
  Partials       26       26              

☔ View full report in Codecov by Sentry.
📢 Have feedback on the report? Share it here.

Comment on lines +165 to +172
if ntthal.duplex_tm(lp.bases, rp.bases) > max_heterodimer_tm:
continue

penalty = score(
Copy link
Collaborator

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

question Naive question - why is duplex_tm() a method on NtThermoAligner, but score() and calculate_long_seq_tm() are standalone functions? Are the latter accessible through primer3?

Copy link
Member Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

duplex_tm() is a complicated thing that does a thermodynamic alignment of two sequences and predicts their Tm, which is why we delegate to ntthal instead of trying to replicate that.

score() is mimicking something in primer3, but is not easily accessible independent of designing primer pairs in primer3.

calculate_long_seq_tm() is so simple it's not worth trying to redirect to primer3.

Comment on lines +151 to +155
for lp in left_primers:
for rp in right_primers:
Copy link
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

itertools.product would help you un-nest this a level:

https://docs.python.org/3/library/itertools.html#itertools.product

@tfenne tfenne force-pushed the tf_minimize_picking branch from 35ef948 to eb5dc15 Compare November 8, 2024 17:47
@tfenne tfenne marked this pull request as ready for review November 8, 2024 21:20
@tfenne tfenne requested a review from nh13 as a code owner November 8, 2024 21:20
Copy link

coderabbitai bot commented Nov 8, 2024

Walkthrough

The pull request introduces significant updates to the prymer Python library, primarily focusing on enhancing the documentation and functionality related to primer pair selection. Key changes include the addition of a new optional parameter, max_heterodimer_tm, to the build_primer_pairs() method, which allows for improved screening of primer pairs based on dimerization criteria. The documentation has been revised to clarify the process of building and selecting primer pairs, emphasizing the new parameter and its implications.

Additionally, the FilteringParams class has been removed, leading to a simplification of function signatures in the picking module. The build_primer_pairs function now yields an iterator instead of returning a list, optimizing memory usage. The scoring method has also been updated to accept individual parameters rather than a configuration object. Corresponding changes have been made to the test suite to reflect these modifications, including the removal of outdated tests and the introduction of new tests that validate the updated functionality.

Assessment against linked issues

Objective Addressed Explanation
Remove build_and_pick_primer_pairs() and pick_top_primer_pairs() (38)

Possibly related PRs

  • feat: use bwa-aln-interactive and upgrade developer's docs #32: The changes in the main PR regarding the build_primer_pairs() method and the introduction of the max_heterodimer_tm parameter are related to the modifications in the tests/api/test_picking.py file, which now includes tests that utilize the updated functionality for primer pair selection and scoring.

Suggested reviewers

  • nh13
  • msto

Thank you for using CodeRabbit. We offer it for free to the OSS community and would appreciate your support in helping us grow. If you find it useful, would you consider giving us a shout-out on your favorite social media?

❤️ Share
🪧 Tips

Chat

There are 3 ways to chat with CodeRabbit:

  • Review comments: Directly reply to a review comment made by CodeRabbit. Example:
    • I pushed a fix in commit <commit_id>, please review it.
    • Generate unit testing code for this file.
    • Open a follow-up GitHub issue for this discussion.
  • Files and specific lines of code (under the "Files changed" tab): Tag @coderabbitai in a new review comment at the desired location with your query. Examples:
    • @coderabbitai generate unit testing code for this file.
    • @coderabbitai modularize this function.
  • PR comments: Tag @coderabbitai in a new PR comment to ask questions about the PR branch. For the best results, please provide a very specific query, as very limited context is provided in this mode. Examples:
    • @coderabbitai gather interesting stats about this repository and render them as a table. Additionally, render a pie chart showing the language distribution in the codebase.
    • @coderabbitai read src/utils.ts and generate unit testing code.
    • @coderabbitai read the files in the src/scheduler package and generate a class diagram using mermaid and a README in the markdown format.
    • @coderabbitai help me debug CodeRabbit configuration file.

Note: Be mindful of the bot's finite context window. It's strongly recommended to break down tasks such as reading entire modules into smaller chunks. For a focused discussion, use review comments to chat about specific files and their changes, instead of using the PR comments.

CodeRabbit Commands (Invoked using PR comments)

  • @coderabbitai pause to pause the reviews on a PR.
  • @coderabbitai resume to resume the paused reviews.
  • @coderabbitai review to trigger an incremental review. This is useful when automatic reviews are disabled for the repository.
  • @coderabbitai full review to do a full review from scratch and review all the files again.
  • @coderabbitai summary to regenerate the summary of the PR.
  • @coderabbitai resolve resolve all the CodeRabbit review comments.
  • @coderabbitai configuration to show the current CodeRabbit configuration for the repository.
  • @coderabbitai help to get help.

Other keywords and placeholders

  • Add @coderabbitai ignore anywhere in the PR description to prevent this PR from being reviewed.
  • Add @coderabbitai summary to generate the high-level summary at a specific location in the PR description.
  • Add @coderabbitai anywhere in the PR title to generate the title automatically.

CodeRabbit Configuration File (.coderabbit.yaml)

  • You can programmatically configure CodeRabbit by adding a .coderabbit.yaml file to the root of your repository.
  • Please see the configuration documentation for more information.
  • If your editor has YAML language server enabled, you can add the path at the top of this file to enable auto-completion and validation: # yaml-language-server: $schema=https://coderabbit.ai/integrations/schema.v2.json

Documentation and Community

  • Visit our Documentation for detailed information on how to use CodeRabbit.
  • Join our Discord Community to get help, request features, and share feedback.
  • Follow us on X/Twitter for updates and announcements.

Copy link

@coderabbitai coderabbitai bot left a comment

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Actionable comments posted: 2

🧹 Outside diff range and nitpick comments (3)
docs/overview.md (1)

53-53: Fix broken reference link.

The reference link for [prymer.api.picking.score] is missing its definition. This needs to be added to maintain documentation integrity.

Add the following at the bottom of the file:

+[prymer.api.picking.score]: https://prymer.readthedocs.io/en/latest/api/picking.html#prymer.api.picking.score
🧰 Tools
🪛 Markdownlint

53-53: Missing link or image reference definition: "prymer.api.picking.score"
Reference links and images should use a label that is defined

(MD052, reference-links-images)

tests/api/test_picking.py (2)

255-259: Refactor repeated assertion logic into a helper function

The assertion logic within your test functions is repeated in multiple places (lines 255-259, 286-291, and 317-323). Refactoring this code into a helper function can improve maintainability and reduce duplication.

You could define a helper function like:

def assert_primer_pair_properties(pair: PrimerPair) -> None:
    assert pair.span.length == len(pair.bases)
    assert pair.amplicon.start == pair.left_primer.span.start
    assert pair.amplicon.end == pair.right_primer.span.end
    assert pair.bases == REF_BASES[pair.amplicon.start - 1 : pair.amplicon.end]

And then update your test functions:

     for pair in pairs:
-        assert pair.span.length == len(pair.bases)
-        assert pair.amplicon.start == pair.left_primer.span.start
-        assert pair.amplicon.end == pair.right_primer.span.end
-        assert pair.bases == REF_BASES[pair.amplicon.start - 1 : pair.amplicon.end]
+        assert_primer_pair_properties(pair)

Also applies to: 286-291, 317-323


244-245: Use constants for primer sequence indices for clarity

In test_build_primer_pairs_single_pair, the indices used to slice REF_BASES (e.g., [200:220], [280:300]) are hard-coded. Defining these indices as constants can improve readability and ease future modifications.

For example:

LEFT_PRIMER_START = 200
LEFT_PRIMER_END = 220
RIGHT_PRIMER_START = 280
RIGHT_PRIMER_END = 300

left_primers = [
    p(
        REF_BASES[LEFT_PRIMER_START:LEFT_PRIMER_END],
        tm=60.1,
        pos=LEFT_PRIMER_START + 1,
        pen=1.0,
    )
]
right_primers = [
    p(
        reverse_complement(REF_BASES[RIGHT_PRIMER_START:RIGHT_PRIMER_END]),
        tm=61.8,
        pos=RIGHT_PRIMER_START + 1,
        pen=1.1,
    )
]
📜 Review details

Configuration used: CodeRabbit UI
Review profile: CHILL

📥 Commits

Reviewing files that changed from the base of the PR and between e9ddc8d and b111c20.

📒 Files selected for processing (4)
  • docs/overview.md (1 hunks)
  • prymer/api/__init__.py (0 hunks)
  • prymer/api/picking.py (4 hunks)
  • tests/api/test_picking.py (1 hunks)
💤 Files with no reviewable changes (1)
  • prymer/api/init.py
🧰 Additional context used
🪛 Markdownlint
docs/overview.md

53-53: Missing link or image reference definition: "prymer.api.picking.score"
Reference links and images should use a label that is defined

(MD052, reference-links-images)

🪛 Gitleaks
tests/api/test_picking.py

50-50: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


51-51: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


53-53: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


55-55: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)

🔇 Additional comments (2)
docs/overview.md (1)

50-52: Documentation accurately reflects the new functionality.

The documentation clearly explains the primer pair building process and introduces the new max_heterodimer_tm parameter. This aligns well with the PR's objective of simplifying the picking functionality while maintaining clear documentation of the core features.

prymer/api/picking.py (1)

136-141: ⚠️ Potential issue

Verify sequence extraction logic for potential off-by-one errors

When fetching sequences using fasta.fetch(), the coordinates are 0-based and half-open intervals. Subtracting 1 from region_start may lead to incorrect sequence extraction. Please verify that the sequence extraction and slicing correctly correspond to the desired amplicon regions without introducing off-by-one errors.

To ensure accurate sequence retrieval, confirm the coordinate system of fasta.fetch() and adjust region_start and region_end accordingly. Consider the following when adjusting the code:

  • fasta.fetch(reference, start, end) retrieves bases from start to end - 1.
  • Ensure that the slicing of bases in amp_bases aligns with the primer positions.

Comment on lines 123 to 124
print(f"Target={target}; lefts={left_primers}.")
print(f"Target={target}; rights={right_primers}.")
Copy link

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

🛠️ Refactor suggestion

Remove debug print statements from production code

The print statements on lines 123-124 may not be suitable for production code as they can clutter the console output and potentially expose sensitive information. Consider removing them or using a logging framework with appropriate log levels.

Apply this diff to remove the debug statements:

-        print(f"Target={target}; lefts={left_primers}.")
-        print(f"Target={target}; rights={right_primers}.")
📝 Committable suggestion

‼️ IMPORTANT
Carefully review the code before committing. Ensure that it accurately replaces the highlighted code, contains no missing lines, and has no issues with indentation. Thoroughly test & benchmark the code to ensure it meets the requirements.

Suggested change
print(f"Target={target}; lefts={left_primers}.")
print(f"Target={target}; rights={right_primers}.")

Comment on lines +88 to +91
if bases is None:
length = rp.span.end - lp.span.start + 1
needed = length - lp.span.length - rp.span.length
bases = lp.bases + ("A" * needed) + reverse_complement(rp.bases)
Copy link

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

⚠️ Potential issue

Prevent potential negative sequence length in function pp

In the pp function, the variable needed is calculated as length - lp.span.length - rp.span.length. If needed becomes negative, multiplying a string by a negative number will raise a ValueError. Consider adding a check to handle cases where needed is negative.

Apply this diff to handle the potential issue:

     if bases is None:
         length = rp.span.end - lp.span.start + 1
         needed = length - lp.span.length - rp.span.length
+        if needed < 0:
+            raise ValueError(f"Negative sequence length calculated in function `pp`: needed={needed}")
         bases = lp.bases + ("A" * needed) + reverse_complement(rp.bases)
📝 Committable suggestion

‼️ IMPORTANT
Carefully review the code before committing. Ensure that it accurately replaces the highlighted code, contains no missing lines, and has no issues with indentation. Thoroughly test & benchmark the code to ensure it meets the requirements.

Suggested change
if bases is None:
length = rp.span.end - lp.span.start + 1
needed = length - lp.span.length - rp.span.length
bases = lp.bases + ("A" * needed) + reverse_complement(rp.bases)
if bases is None:
length = rp.span.end - lp.span.start + 1
needed = length - lp.span.length - rp.span.length
if needed < 0:
raise ValueError(f"Negative sequence length calculated in function `pp`: needed={needed}")
bases = lp.bases + ("A" * needed) + reverse_complement(rp.bases)

Copy link
Collaborator

@msto msto left a comment

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I don't have any objections to the refactoring.

I do continue to struggle to understand the motivation for reimplementing primer pair picking and scoring in a less performant language, rather than using primer3 to design and filter pairs where possible.

I understand that primer3 does not support all the possible flavors of filtering we sometimes have to implement (e.g. I don't think its design algorithm supports filtering based on heterodimerization tm), but I think that it's generally simpler and less prone to inconsistency to rely on it for the features it does provide.

Comment on lines +105 to +107
Only primer pairs that meet the requirements for amplicon sizes and tms will be returned.
In addition, if `max_heterodimer_tm` is provided then primer pairs with a heterodimer tm
exceeding the maximum will also be discarded.
Copy link
Collaborator

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

question Why is this necessary when primer3 will apply these constraints to designed primer pairs if they are specified? e.g. specifying PRIMER_PRODUCT_MIN_TM and PRIMER_PRODUCT_MAX_TM will constrain the pairs returned by primer3 to the provided range

Copy link
Member Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Because this is used when designing left and right primers independently - so primer3 is not emitting pairs and not cannot check these constraints.

Copy link

@coderabbitai coderabbitai bot left a comment

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Actionable comments posted: 0

🧹 Outside diff range and nitpick comments (3)
prymer/api/picking.py (1)

134-134: Consider improving FastaFile path handling

The f-string for the FastaFile path is unnecessary and could be simplified.

-    with FastaFile(f"{fasta_path}") as fasta:
+    with FastaFile(fasta_path) as fasta:
tests/api/test_picking.py (2)

297-332: Consider adding edge cases for heterodimer filtering tests

While the current tests cover the basic functionality, consider adding these edge cases:

  1. Test with max_heterodimer_tm=0 to verify complete filtering
  2. Test with very high max_heterodimer_tm to verify no filtering

48-59: Consider moving test sequences to fixtures

The hardcoded DNA sequences could be moved to fixtures to improve maintainability and reusability across tests. This would also make it easier to modify test data when needed.

Example refactor:

@pytest.fixture
def test_sequences() -> dict[str, str]:
    return {
        "ref_bases": """
            CCTGCTGGTTTTATTTCTGCTACTT...
        """.strip().replace("\n", ""),
        "gc_rich": "CGCGCGCGCGCGCGCGCGCG",
        "at_rich": "CTGCTGCTGCTGCTGCTGCT"
    }
🧰 Tools
🪛 Gitleaks

50-50: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


51-51: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


53-53: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


55-55: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)

📜 Review details

Configuration used: CodeRabbit UI
Review profile: CHILL

📥 Commits

Reviewing files that changed from the base of the PR and between b111c20 and 9addfdc.

📒 Files selected for processing (2)
  • prymer/api/picking.py (4 hunks)
  • tests/api/test_picking.py (1 hunks)
🧰 Additional context used
🪛 Gitleaks
tests/api/test_picking.py

50-50: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


51-51: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


53-53: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)


55-55: Identified a pattern that may indicate AWS credentials, risking unauthorized cloud resource access and data breaches on AWS platforms.

(aws-access-token)

🔇 Additional comments (10)
prymer/api/picking.py (8)

4-7: LGTM: Clear and focused module documentation

The updated docstring accurately reflects the module's simplified functionality after removing deprecated functions.


Line range hint 34-90: LGTM: Well-structured penalty calculation with clear parameter dependencies

The refactored score function improves clarity by:

  • Making dependencies explicit through individual parameters
  • Maintaining clear documentation of penalty calculations
  • Using type hints effectively

102-102: LGTM: Memory-efficient Iterator return type

The change to return an Iterator instead of a list improves memory efficiency when dealing with large sets of primer pairs.


127-131: LGTM: Good input validation

The added validation ensures consistency between primers and target reference names, preventing potential runtime errors.


124-124: Fix potential iterator consumption issue

The any() function will consume elements from iterators. Since this is a duplicate of a previous comment that hasn't been addressed, I'll skip generating a new suggestion.


141-142: Consider using itertools.product for nested iteration

The nested loops could be simplified using itertools.product. This is a duplicate of a previous comment that hasn't been addressed, so I'll skip generating a new suggestion.


146-149: LGTM: Efficient amplicon sequence extraction

The code efficiently extracts the amplicon sequence using relative positions from the fetched region.


155-158: LGTM: Optional heterodimer temperature check

The addition of an optional heterodimer temperature check provides flexibility while maintaining performance when the check isn't needed.

tests/api/test_picking.py (2)

86-102: Previous review comment about negative sequence length is still applicable

The potential issue with negative sequence length calculation in the pp function hasn't been addressed yet.


106-209: Well-structured and comprehensive test suite for scoring functionality

The test coverage is thorough, covering various edge cases and realistic scenarios. The use of pytest.approx for floating-point comparisons and clear test organization makes the tests robust and maintainable.

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

Successfully merging this pull request may close these issues.

Remove build_and_pick_primer_pairs() and pick_top_primer_pairs()
3 participants