chore: add unit tests

prymer/offtarget/bwa.py

@@ -339,6 +339,7 @@ def map_all(self, queries: list[Query]) -> list[BwaResult]:
         for query in queries:
             # get the next alignment and convert to a result
             line: str = next(self._subprocess.stdout).strip()
+            assert not line.startswith("@"), f"SAM record must not start with '@'! {line}"
             alignment = AlignedSegment.fromstring(line, self.header)
             results.append(self._to_result(query=query, rec=alignment))
 

tests/offtarget/test_bwa.py

@@ -2,6 +2,8 @@
 from dataclasses import replace
 from pathlib import Path
 from tempfile import NamedTemporaryFile
+from typing import TypeAlias
+from typing import cast
 
 import pytest
 from fgpyo.sam import Cigar
@@ -12,6 +14,9 @@
 from prymer.offtarget.bwa import BwaHit
 from prymer.offtarget.bwa import Query
 
+SamHeaderType: TypeAlias = dict[str, dict[str, str] | list[dict[str, str]]]
+"""A type alias for a SAM sequence header dictionary."""
+
 
 @pytest.mark.parametrize("bases", [None, ""])
 def test_query_no_bases(bases: str | None) -> None:
@@ -68,6 +73,19 @@ def test_hit_build_rc() -> None:
     assert hit_r.negative is True
 
 
+def test_header_is_properly_constructed(ref_fasta: Path) -> None:
+    """Tests that bwa will return a properly constructed header."""
+    with BwaAlnInteractive(ref=ref_fasta, max_hits=1) as bwa:
+        header: SamHeaderType = bwa.header.to_dict()
+        assert set(header.keys()) == {"HD", "SQ", "PG"}
+        assert header["HD"] == {"GO": "query", "SO": "unsorted", "VN": "1.5"}
+        assert header["SQ"] == [{"LN": 10001, "SN": "chr1"}]
+        assert len(header["PG"]) == 1
+        program_group: dict[str, str] = cast(list[dict[str, str]], header["PG"])[0]
+        program_group["ID"] = "bwa"
+        program_group["PN"] = "bwa"
+
+
 def test_map_one_uniquely_mapped(ref_fasta: Path) -> None:
     """Tests that bwa maps one hit when a query uniquely maps."""
     query = Query(bases="TCTACTAAAAATACAAAAAATTAGCTGGGCATGATGGCATGCACCTGTAATCCCGCTACT", id="NA")