✅ add tests for export_fasta and read_fasta

tests/testthat/data/test.fa

@@ -0,0 +1,8 @@
+>A
+TTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAG
+>B
+TTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAG
+>C
+TTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAG
+>D
+TTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAG

tests/testthat/test-fasta.R

@@ -0,0 +1,44 @@
+test_that("read_fasta works", {
+  fa_df <- read_fasta('data/test.fa')
+  expect_equal(names(fa_df), c('strain', 'sequence'))
+  expect_equal(fa_df$strain, c('A', 'B', 'C', 'D'))
+  expect_equal(fa_df$sequence[4], 'TTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAG')
+})
+
+
+test_that("export_fasta works", {
+
+  # Define a temporary file for testing
+  temp_file <- tempfile(fileext = ".fasta")
+
+  # Mock seqs data frame
+  seqs <- data.frame(country = c("Country1", "Country2"),
+                     pangolin_lineage = c("Lineage1", "Lineage2"),
+                     accession_id = c("Accession1", "Accession2"),
+                     date = as.Date(c("2023-01-01", "2023-02-01")),
+                     description = c("Description1", "Description2"),
+                     sequence = c("AGCT", "TCGA"))
+
+  # Apply the function
+  export_fasta(seqs, temp_file, columns = c("country", "pangolin_lineage", "accession_id", "date"), date_format = "%Y-%m")
+
+  # Check if file exists
+  expect_true(file.exists(temp_file))
+
+  # Read the generated file
+  fasta_content <- readLines(temp_file)
+
+  # Check the format of the FASTA headers
+  fasta_headers <- fasta_content[seq(1, length(fasta_content), 2)]
+  expected_headers <- c(">Country1@Lineage1@Accession1@2023-01",
+                        ">Country2@Lineage2@Accession2@2023-02")
+  expect_equal(fasta_headers, expected_headers)
+
+  # Check the sequences
+  fasta_sequences <- trimws(fasta_content[seq(2, length(fasta_content), 2)])
+  expected_sequences <- c("AGCT", "TCGA")
+  expect_equal(fasta_sequences, expected_sequences)
+
+  # Remove temporary file
+  unlink(temp_file)
+})