Skip to content

Commit

Permalink
feat: added global env directive, closes #11
Browse files Browse the repository at this point in the history
  • Loading branch information
@m-jahn
m-jahn committed Nov 6, 2024
1 parent 3b868c4 commit f9dd861
Show file tree
Hide file tree
Showing 4 changed files with 67 additions and 56 deletions.
4 changes: 4 additions & 0 deletions .gitignore
View file
Original file line number Diff line number Diff line change
Expand Up @@ -8,6 +8,10 @@ resources/**
!.gitignore
!.gitattributes
!.editorconfig
**.conda
**.condarc
**.cache
**.java

# Custom additions
Notes.md
Expand Down
108 changes: 54 additions & 54 deletions README.md
View file
Original file line number Diff line number Diff line change
@@ -1,7 +1,7 @@
# snakemake-bacterial-riboseq

![Platform](https://img.shields.io/badge/platform-all-green)
[![Snakemake](https://img.shields.io/badge/snakemake-≥7.0.0-brightgreen.svg)](https://snakemake.github.io)
[![Snakemake](https://img.shields.io/badge/snakemake-≥8.0.0-brightgreen.svg)](https://snakemake.github.io)
[![Tests](https://github.com/MPUSP/snakemake-bacterial-riboseq/actions/workflows/main.yml/badge.svg)](https://github.com/MPUSP/snakemake-bacterial-riboseq/actions/workflows/main.yml)
[![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)
[![run with singularity](https://img.shields.io/badge/run%20with-singularity-1D355C.svg?labelColor=000000)](https://sylabs.io/docs/)
Expand Down Expand Up @@ -133,69 +133,69 @@ snakemake --dry-run
To run the complete workflow with test files using **`conda`**, execute the following command. The definition of the number of compute cores is mandatory.

```bash
snakemake --cores 10 --use-conda --directory .test
snakemake --cores 10 --sdm conda --directory .test
```

To run the workflow with **singularity**, use:
To run the workflow with **singularity** / **apptainer**, use:

```bash
snakemake --cores 10 --use-singularity --use-conda --directory .test
snakemake --cores 10 --sdm conda apptainer --directory .test
```

### Parameters

This table lists all parameters that can be used to run the workflow.

| parameter | type | details | default |
| ---------------------------- | ---- | ------------------------------------------- | ---------------------------------------------------- |
| **samplesheet** | | | |
| path | str | path to samplesheet, mandatory | "config/samples.tsv" |
| **get_genome** | | | |
| database | str | one of `manual`, `ncbi` | `ncbi` |
| assembly | str | RefSeq ID | `GCF_000006785.2` |
| fasta | str | optional path to fasta file | Null |
| gff | str | optional path to gff file | Null |
| gff_source_type | str | list of name/value pairs for GFF source | see config file |
| **cutadapt** | | | |
| fivep_adapter | str | sequence of the 5' adapter | Null |
| threep_adapter | str | sequence of the 3' adapter | `ATCGTAGATCGGAAGAGCACACGTCTGAA` |
| default | str | additional options passed to `cutadapt` | [`-q 10 `, `-m 22 `, `-M 52`, `--overlap=3`] |
| **umi_extraction** | | | |
| method | str | one of `string` or `regex`, see manual | `regex` |
| pattern | str | string or regular expression | `^(?P<umi_0>.{5}).*(?P<umi_1>.{2})$` |
| **umi_dedup** | | | |
| options | str | default options for deduplication | see config file |
| **star** | | | |
| index | str | location of genome index; if Null, is made | Null |
| genomeSAindexNbases | num | length of pre-indexing string, see STAR man | 9 |
| multi | num | max number of loci read is allowed to map | 10 |
| sam_multi | num | max number of alignments reported for read | 1 |
| intron_max | num | max length of intron; 0 = automatic choice | 1 |
| default | str | default options for STAR aligner | see config file |
| **extract_features** | | | |
| biotypes | str | biotypes to exclude from mapping | [`rRNA`, `tRNA`] |
| CDS | str | CDS type to include for mapping | [`protein_coding`] |
| **bedtools_intersect** | | | |
| defaults | str | remove hits, sense strand, min overlap 20% | [`-v `, `-s `, `-f 0.2`] |
| **annotate_orfs** | | | |
| window_size | num | size of 5'-UTR added to CDS | 30 |
| **shift_reads** | | | |
| window_size | num | start codon window to determine shift | 30 |
| read_length | num | size range of reads to use for shifting | [27, 45] |
| end_alignment | str | end used for alignment of RiboSeq reads | `3prime` |
| shift_table | str | optional table with offsets per read length | Null |
| export_bigwig | str | export shifted reads as bam file | True |
| export_ofst | str | export shifted reads as ofst file | False |
| skip_shifting | str | skip read shifting entirely | False |
| skip_length_filter | str | skip filtering reads by length | False |
| **multiqc** | | | |
| config | str | path to multiqc config | `config/multiqc_config.yml` |
| **report** | | | |
| export_figures | bool | export figures as `.svg` and `.png` | True |
| export_dir | str | sub-directory for figure export | `figures/` |
| figure_width | num | standard figure width in px | 875 |
| figure_height | num | standard figure height in px | 500 |
| figure_resolution | num | standard figure resolution in dpi | 125 |
| parameter | type | details | default |
| ---------------------- | ---- | ------------------------------------------- | -------------------------------------------- |
| **samplesheet** | | | |
| path | str | path to samplesheet, mandatory | "config/samples.tsv" |
| **get_genome** | | | |
| database | str | one of `manual`, `ncbi` | `ncbi` |
| assembly | str | RefSeq ID | `GCF_000006785.2` |
| fasta | str | optional path to fasta file | Null |
| gff | str | optional path to gff file | Null |
| gff_source_type | str | list of name/value pairs for GFF source | see config file |
| **cutadapt** | | | |
| fivep_adapter | str | sequence of the 5' adapter | Null |
| threep_adapter | str | sequence of the 3' adapter | `ATCGTAGATCGGAAGAGCACACGTCTGAA` |
| default | str | additional options passed to `cutadapt` | [`-q 10 `, `-m 22 `, `-M 52`, `--overlap=3`] |
| **umi_extraction** | | | |
| method | str | one of `string` or `regex`, see manual | `regex` |
| pattern | str | string or regular expression | `^(?P<umi_0>.{5}).*(?P<umi_1>.{2})$` |
| **umi_dedup** | | | |
| options | str | default options for deduplication | see config file |
| **star** | | | |
| index | str | location of genome index; if Null, is made | Null |
| genomeSAindexNbases | num | length of pre-indexing string, see STAR man | 9 |
| multi | num | max number of loci read is allowed to map | 10 |
| sam_multi | num | max number of alignments reported for read | 1 |
| intron_max | num | max length of intron; 0 = automatic choice | 1 |
| default | str | default options for STAR aligner | see config file |
| **extract_features** | | | |
| biotypes | str | biotypes to exclude from mapping | [`rRNA`, `tRNA`] |
| CDS | str | CDS type to include for mapping | [`protein_coding`] |
| **bedtools_intersect** | | | |
| defaults | str | remove hits, sense strand, min overlap 20% | [`-v `, `-s `, `-f 0.2`] |
| **annotate_orfs** | | | |
| window_size | num | size of 5'-UTR added to CDS | 30 |
| **shift_reads** | | | |
| window_size | num | start codon window to determine shift | 30 |
| read_length | num | size range of reads to use for shifting | [27, 45] |
| end_alignment | str | end used for alignment of RiboSeq reads | `3prime` |
| shift_table | str | optional table with offsets per read length | Null |
| export_bigwig | str | export shifted reads as bam file | True |
| export_ofst | str | export shifted reads as ofst file | False |
| skip_shifting | str | skip read shifting entirely | False |
| skip_length_filter | str | skip filtering reads by length | False |
| **multiqc** | | | |
| config | str | path to multiqc config | `config/multiqc_config.yml` |
| **report** | | | |
| export_figures | bool | export figures as `.svg` and `.png` | True |
| export_dir | str | sub-directory for figure export | `figures/` |
| figure_width | num | standard figure width in px | 875 |
| figure_height | num | standard figure height in px | 500 |
| figure_resolution | num | standard figure resolution in dpi | 125 |

## Authors

Expand Down
5 changes: 3 additions & 2 deletions workflow/Snakefile
View file
Original file line number Diff line number Diff line change
Expand Up @@ -8,13 +8,14 @@
# may apply. #
# ----------------------------------------------------- #

conda:
"envs/global.yml"

import os
import pandas as pd
from datetime import date
from snakemake.utils import min_version

# min_version("7.0")

__author__ = "Rina Ahmed-Begrich, Michael Jahn"
__year__ = str(date.today()).split("-")[0]

Expand Down
6 changes: 6 additions & 0 deletions workflow/envs/global.yml
View file
Original file line number Diff line number Diff line change
@@ -0,0 +1,6 @@
name: global
channels:
- conda-forge
- bioconda
dependencies:
- pandas=2.2.2

0 comments on commit f9dd861

Please sign in to comment.