Skip to content

Latest commit

 

History

History
652 lines (513 loc) · 25.5 KB

File metadata and controls

652 lines (513 loc) · 25.5 KB

DADA2 pipeline

library(Rcpp)
library(stats)
library(dada2)
library(ggplot2)

Dada2 pipeline

Get Data

git_ignore_path <- "BioinformaticsPractice/.gitignore"
path <- "BioinformaticsPractice/.gitignore/MiSeq_SOP"
list.files(path)
##  [1] "F3D0_S188_L001_R1_001.fastq"   "F3D0_S188_L001_R2_001.fastq"  
##  [3] "F3D1_S189_L001_R1_001.fastq"   "F3D1_S189_L001_R2_001.fastq"  
##  [5] "F3D141_S207_L001_R1_001.fastq" "F3D141_S207_L001_R2_001.fastq"
##  [7] "F3D142_S208_L001_R1_001.fastq" "F3D142_S208_L001_R2_001.fastq"
##  [9] "F3D143_S209_L001_R1_001.fastq" "F3D143_S209_L001_R2_001.fastq"
## [11] "F3D144_S210_L001_R1_001.fastq" "F3D144_S210_L001_R2_001.fastq"
## [13] "F3D145_S211_L001_R1_001.fastq" "F3D145_S211_L001_R2_001.fastq"
## [15] "F3D146_S212_L001_R1_001.fastq" "F3D146_S212_L001_R2_001.fastq"
## [17] "F3D147_S213_L001_R1_001.fastq" "F3D147_S213_L001_R2_001.fastq"
## [19] "F3D148_S214_L001_R1_001.fastq" "F3D148_S214_L001_R2_001.fastq"
## [21] "F3D149_S215_L001_R1_001.fastq" "F3D149_S215_L001_R2_001.fastq"
## [23] "F3D150_S216_L001_R1_001.fastq" "F3D150_S216_L001_R2_001.fastq"
## [25] "F3D2_S190_L001_R1_001.fastq"   "F3D2_S190_L001_R2_001.fastq"  
## [27] "F3D3_S191_L001_R1_001.fastq"   "F3D3_S191_L001_R2_001.fastq"  
## [29] "F3D5_S193_L001_R1_001.fastq"   "F3D5_S193_L001_R2_001.fastq"  
## [31] "F3D6_S194_L001_R1_001.fastq"   "F3D6_S194_L001_R2_001.fastq"  
## [33] "F3D7_S195_L001_R1_001.fastq"   "F3D7_S195_L001_R2_001.fastq"  
## [35] "F3D8_S196_L001_R1_001.fastq"   "F3D8_S196_L001_R2_001.fastq"  
## [37] "F3D9_S197_L001_R1_001.fastq"   "F3D9_S197_L001_R2_001.fastq"  
## [39] "filtered"                      "HMP_MOCK.v35.fasta"           
## [41] "Mock_S280_L001_R1_001.fastq"   "Mock_S280_L001_R2_001.fastq"  
## [43] "mouse.dpw.metadata"            "mouse.time.design"            
## [45] "stability.batch"               "stability.files"

These are 16s rRNA gene from gut samples collected longitudinally from mouse.

Used Amplicon in V4 region

# These are the forward reads of the data
fnFs <- sort(list.files(path, pattern = "_R1_001.fastq", full.names = TRUE))
# These are the reverse reads
fnRs <- sort(list.files(path, pattern = "_R2_001.fastq", full.names = TRUE))
sample.names <- sapply(strsplit(basename(fnFs), "_"), `[`, 1)

Plot Quality profiles

Now you can plot the quality profiles by file names

For amplicon sequencing data, you usually aim for 10k+ reads, so the absolute amount of reads are not that large. The Quality score is usually kept above 10 = 10% are not great 20 is 1% due to logarithmic scoring.

p1 <- plotQualityProfile(fnFs[1:2])

You can see that the quality drops hard in the last 10 sequences We can trim the seqeunce at 240 bp You should check all the data before deciding.

p1 + scale_x_continuous(limits = c(200, 250))
## Warning: Removed 7624 rows containing missing values or values outside the scale range
## (`geom_tile()`).

## Warning: Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).

## Warning: Removed 2 rows containing missing values or values outside the scale range
## (`geom_text()`).

## Warning: Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).

For the reverse datasets, we might have to trim over 100 basepairs at the end We can trim the read to 160 bp for reverse reads.

p2 <- plotQualityProfile(fnRs[1:2])
p2 + scale_x_continuous(limits = c(100, 250))
## Warning: Removed 3284 rows containing missing values or values outside the scale range
## (`geom_tile()`).

## Warning: Removed 100 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 100 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 100 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 100 rows containing missing values or values outside the scale range
## (`geom_line()`).

## Warning: Removed 2 rows containing missing values or values outside the scale range
## (`geom_text()`).

## Warning: Removed 100 rows containing missing values or values outside the scale range
## (`geom_line()`).

p2 + scale_x_continuous(limits = c(150, 200))
## Warning: Removed 7425 rows containing missing values or values outside the scale range
## (`geom_tile()`).

## Warning: Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).
## Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).

## Warning: Removed 2 rows containing missing values or values outside the scale range
## (`geom_text()`).

## Warning: Removed 200 rows containing missing values or values outside the scale range
## (`geom_line()`).

Filter Data

filtFs <- file.path(path, "filtered", paste0(sample.names, "_F_filt.fastq.gz"))
filtRs <- file.path(path, "filtered", paste0(sample.names, "_R_filt.fastq.gz"))
# the first 4 values are forward, forward filt, rev, rev filt
# trunc len is the length of each truncation on datasets. if shorter its discarded
# truncQ is 2. Truncates reads at the first instance of quality score less so it guarantees every bp to be higher quality
#rm.phiX removes all genes that match the phiX genome
# maxEE can influence the running speed of codes. with tighter EE, you get less reads. Relaxing maxEE, you get more reads.
# Max EE is the sum of numbers represented through quality score for instance quality score 10 -> 0.1 is added to maxEE
out <- filterAndTrim(fnFs, filtFs, fnRs, filtRs, truncLen=c(240,160),
              maxN=0, maxEE=c(2,2), truncQ=2, rm.phix=TRUE,
              compress=TRUE, multithread=FALSE)
head(out)
##                               reads.in reads.out
## F3D0_S188_L001_R1_001.fastq       7793      7113
## F3D1_S189_L001_R1_001.fastq       5869      5299
## F3D141_S207_L001_R1_001.fastq     5958      5463
## F3D142_S208_L001_R1_001.fastq     3183      2914
## F3D143_S209_L001_R1_001.fastq     3178      2941
## F3D144_S210_L001_R1_001.fastq     4827      4312

For ITS sequencing it is undesirable to use fix-length truncating due to the large length variation at that locus. Remember to take out trunclen in that case.

Zymo research has developed a tool called figaro which you can use to decide dada2 truncation length.

Learn errors

errF <- learnErrors(filtFs, multithread=TRUE)
## 33514080 total bases in 139642 reads from 20 samples will be used for learning the error rates.
errR <- learnErrors(filtRs, multithread=TRUE)
## 22342720 total bases in 139642 reads from 20 samples will be used for learning the error rates.
plotErrors(errF, nominalQ=TRUE)
## Warning in scale_y_log10(): log-10 transformation introduced infinite values.
## log-10 transformation introduced infinite values.

The red line is the expected error by the definition of Quality Score. The black line is the machine learning convergence of error rates. dots are the observed error rates

dada sample inference algorithms

dadaFs <- dada(filtFs, err = errF, multithread = FALSE)
## Sample 1 - 7113 reads in 1979 unique sequences.
## Sample 2 - 5299 reads in 1639 unique sequences.
## Sample 3 - 5463 reads in 1477 unique sequences.
## Sample 4 - 2914 reads in 904 unique sequences.
## Sample 5 - 2941 reads in 939 unique sequences.
## Sample 6 - 4312 reads in 1267 unique sequences.
## Sample 7 - 6741 reads in 1756 unique sequences.
## Sample 8 - 4560 reads in 1438 unique sequences.
## Sample 9 - 15637 reads in 3590 unique sequences.
## Sample 10 - 11413 reads in 2762 unique sequences.
## Sample 11 - 12017 reads in 3021 unique sequences.
## Sample 12 - 5032 reads in 1566 unique sequences.
## Sample 13 - 18075 reads in 3707 unique sequences.
## Sample 14 - 6250 reads in 1479 unique sequences.
## Sample 15 - 4052 reads in 1195 unique sequences.
## Sample 16 - 7369 reads in 1832 unique sequences.
## Sample 17 - 4765 reads in 1183 unique sequences.
## Sample 18 - 4871 reads in 1382 unique sequences.
## Sample 19 - 6504 reads in 1709 unique sequences.
## Sample 20 - 4314 reads in 897 unique sequences.
dadaRs <- dada(filtRs, err = errR, multithread = FALSE)
## Sample 1 - 7113 reads in 1660 unique sequences.
## Sample 2 - 5299 reads in 1349 unique sequences.
## Sample 3 - 5463 reads in 1335 unique sequences.
## Sample 4 - 2914 reads in 853 unique sequences.
## Sample 5 - 2941 reads in 880 unique sequences.
## Sample 6 - 4312 reads in 1286 unique sequences.
## Sample 7 - 6741 reads in 1803 unique sequences.
## Sample 8 - 4560 reads in 1265 unique sequences.
## Sample 9 - 15637 reads in 3414 unique sequences.
## Sample 10 - 11413 reads in 2522 unique sequences.
## Sample 11 - 12017 reads in 2771 unique sequences.
## Sample 12 - 5032 reads in 1415 unique sequences.
## Sample 13 - 18075 reads in 3290 unique sequences.
## Sample 14 - 6250 reads in 1390 unique sequences.
## Sample 15 - 4052 reads in 1134 unique sequences.
## Sample 16 - 7369 reads in 1635 unique sequences.
## Sample 17 - 4765 reads in 1084 unique sequences.
## Sample 18 - 4871 reads in 1161 unique sequences.
## Sample 19 - 6504 reads in 1502 unique sequences.
## Sample 20 - 4314 reads in 732 unique sequences.
dadaFs[[1]]
## dada-class: object describing DADA2 denoising results
## 128 sequence variants were inferred from 1979 input unique sequences.
## Key parameters: OMEGA_A = 1e-40, OMEGA_C = 1e-40, BAND_SIZE = 16

Merge the paired reads

mergers <- mergePairs(dadaFs, filtFs, dadaRs, filtRs, verbose = TRUE)
## 6540 paired-reads (in 107 unique pairings) successfully merged out of 6891 (in 197 pairings) input.

## 5028 paired-reads (in 101 unique pairings) successfully merged out of 5190 (in 157 pairings) input.

## 4986 paired-reads (in 81 unique pairings) successfully merged out of 5267 (in 166 pairings) input.

## 2595 paired-reads (in 52 unique pairings) successfully merged out of 2754 (in 108 pairings) input.

## 2553 paired-reads (in 60 unique pairings) successfully merged out of 2785 (in 119 pairings) input.

## 3646 paired-reads (in 55 unique pairings) successfully merged out of 4109 (in 157 pairings) input.

## 6079 paired-reads (in 81 unique pairings) successfully merged out of 6514 (in 198 pairings) input.

## 3968 paired-reads (in 91 unique pairings) successfully merged out of 4388 (in 187 pairings) input.

## 14233 paired-reads (in 143 unique pairings) successfully merged out of 15355 (in 352 pairings) input.

## 10528 paired-reads (in 120 unique pairings) successfully merged out of 11165 (in 278 pairings) input.

## 11154 paired-reads (in 137 unique pairings) successfully merged out of 11797 (in 298 pairings) input.

## 4349 paired-reads (in 85 unique pairings) successfully merged out of 4802 (in 179 pairings) input.

## 17431 paired-reads (in 153 unique pairings) successfully merged out of 17812 (in 272 pairings) input.

## 5850 paired-reads (in 81 unique pairings) successfully merged out of 6095 (in 159 pairings) input.

## 3716 paired-reads (in 86 unique pairings) successfully merged out of 3894 (in 147 pairings) input.

## 6865 paired-reads (in 99 unique pairings) successfully merged out of 7191 (in 187 pairings) input.

## 4426 paired-reads (in 67 unique pairings) successfully merged out of 4603 (in 127 pairings) input.

## 4576 paired-reads (in 101 unique pairings) successfully merged out of 4739 (in 174 pairings) input.

## 6092 paired-reads (in 109 unique pairings) successfully merged out of 6315 (in 173 pairings) input.

## 4269 paired-reads (in 20 unique pairings) successfully merged out of 4281 (in 28 pairings) input.
head(mergers[[1]])
##                                                                                                                                                                                                                                                       sequence
## 1 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGAAGATCAAGTCAGCGGTAAAATTGAGAGGCTCAACCTCTTCGAGCCGTTGAAACTGGTTTTCTTGAGTGAGCGAGAAGTATGCGGAATGCGTGGTGTAGCGGTGAAATGCATAGATATCACGCAGAACTCCGATTGCGAAGGCAGCATACCGGCGCTCAACTGACGCTCATGCACGAAAGTGTGGGTATCGAACAGG
## 2 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGCCAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTACAGCCGTTGAAACTGCCGGGCTCGAGTGGGCGAGAAGTATGCGGAATGCGTGGTGTAGCGGTGAAATGCATAGATATCACGCAGAACCCCGATTGCGAAGGCAGCATACCGGCGCCCTACTGACGCTGAGGCACGAAAGTGCGGGGATCAAACAGG
## 3 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGCTGTTAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGGCGGCCTCGAGTGGGCGAGAAGTATGCGGAATGCGTGGTGTAGCGGTGAAATGCATAGATATCACGCAGAACTCCGATTGCGAAGGCAGCATACCGGCGCCCGACTGACGCTGAGGCACGAAAGCGTGGGTATCGAACAGG
## 4 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGCTTTTAAGTCAGCGGTAAAAATTCGGGGCTCAACCCCGTCCGGCCGTTGAAACTGGGGGCCTTGAGTGGGCGAGAAGAAGGCGGAATGCGTGGTGTAGCGGTGAAATGCATAGATATCACGCAGAACCCCGATTGCGAAGGCAGCCTTCCGGCGCCCTACTGACGCTGAGGCACGAAAGTGCGGGGATCGAACAGG
## 5 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGACTCTCAAGTCAGCGGTCAAATCGCGGGGCTCAACCCCGTTCCGCCGTTGAAACTGGGAGCCTTGAGTGCGCGAGAAGTAGGCGGAATGCGTGGTGTAGCGGTGAAATGCATAGATATCACGCAGAACTCCGATTGCGAAGGCAGCCTACCGGCGCGCAACTGACGCTCATGCACGAAAGCGTGGGTATCGAACAGG
## 6 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAAAGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGTGTAGCGGTGAAATGCATAGATATCACGCAGAACTCCGATTGCGAAGGCAGCATACCGGCGCCCTACTGACGCTGAGGCACGAAAGCGTGGGTATCGAACAGG
##   abundance forward reverse nmatch nmismatch nindel prefer accept
## 1       579       1       1    148         0      0      1   TRUE
## 2       470       2       2    148         0      0      2   TRUE
## 3       449       3       4    148         0      0      1   TRUE
## 4       430       4       3    148         0      0      2   TRUE
## 5       345       5       6    148         0      0      1   TRUE
## 6       282       6       5    148         0      0      2   TRUE

Construct Sequence table

seqtab <- makeSequenceTable(mergers)
dim(seqtab)
## [1]  20 293
table(nchar(getSequences(seqtab)))
## 
## 251 252 253 254 255 
##   1  88 196   6   2

Remove chimeras

seqtab.nochim <- removeBimeraDenovo(seqtab, method="consensus", multithread=TRUE, verbose=TRUE)
## Identified 61 bimeras out of 293 input sequences.
dim(seqtab.nochim)
## [1]  20 232

bimeras were around 3.5% of the data.

sum(seqtab.nochim)/sum(seqtab)
## [1] 0.9640374

Track reads through pipeline

getN <- function(x) sum(getUniques(x))
track <- cbind(out, sapply(dadaFs, getN), sapply(dadaRs, getN), sapply(mergers, getN), rowSums(seqtab.nochim))
colnames(track) <- c("input", "filtered", "denoisedF", "denoisedR", "merged", "nochim")
rownames(track) <- sample.names
head(track)
##        input filtered denoisedF denoisedR merged nochim
## F3D0    7793     7113      6976      6979   6540   6528
## F3D1    5869     5299      5227      5239   5028   5017
## F3D141  5958     5463      5331      5357   4986   4863
## F3D142  3183     2914      2799      2830   2595   2521
## F3D143  3178     2941      2822      2868   2553   2519
## F3D144  4827     4312      4151      4228   3646   3507

Assign Taxonomy

taxa <- assignTaxonomy(seqtab.nochim, paste0(git_ignore_path, "/silva_nr_v132_train_set.fa.gz"), multithread=FALSE)

can do exact matching between ASVs and sequence reference strains. 100% but thats not realistic

taxa.print <- taxa 
rownames(taxa.print) <- NULL
head(taxa.print)
##      Kingdom    Phylum          Class         Order           Family          
## [1,] "Bacteria" "Bacteroidetes" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
## [2,] "Bacteria" "Bacteroidetes" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
## [3,] "Bacteria" "Bacteroidetes" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
## [4,] "Bacteria" "Bacteroidetes" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
## [5,] "Bacteria" "Bacteroidetes" "Bacteroidia" "Bacteroidales" "Bacteroidaceae"
## [6,] "Bacteria" "Bacteroidetes" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
##      Genus        
## [1,] NA           
## [2,] NA           
## [3,] NA           
## [4,] NA           
## [5,] "Bacteroides"
## [6,] NA

Please check the orientation of your datsets if there are errors in this datasets. tryRC = TRUE

Evaluate the Accuracy

unqs.mock <- seqtab.nochim["Mock_F_filt.fastq.gz",]
unqs.mock <- sort(unqs.mock[unqs.mock>0], decreasing=TRUE) # Drop ASVs absent in the Mock
cat("DADA2 inferred", length(unqs.mock), "sample sequences present in the Mock community.\n")
## DADA2 inferred 20 sample sequences present in the Mock community.
mock.ref <- getSequences(file.path(path, "HMP_MOCK.v35.fasta"))
match.ref <- sum(sapply(names(unqs.mock), function(x) any(grepl(x, mock.ref))))
cat("Of those,", sum(match.ref), "were exact matches to the expected reference sequences.\n")
## Of those, 20 were exact matches to the expected reference sequences.

Continuing with Phyloseq

library(phyloseq)
library(Biostrings)
## Loading required package: BiocGenerics

## 
## Attaching package: 'BiocGenerics'

## The following objects are masked from 'package:stats':
## 
##     IQR, mad, sd, var, xtabs

## The following objects are masked from 'package:base':
## 
##     anyDuplicated, aperm, append, as.data.frame, basename, cbind,
##     colnames, dirname, do.call, duplicated, eval, evalq, Filter, Find,
##     get, grep, grepl, intersect, is.unsorted, lapply, Map, mapply,
##     match, mget, order, paste, pmax, pmax.int, pmin, pmin.int,
##     Position, rank, rbind, Reduce, rownames, sapply, setdiff, sort,
##     table, tapply, union, unique, unsplit, which.max, which.min

## Loading required package: S4Vectors

## Loading required package: stats4

## 
## Attaching package: 'S4Vectors'

## The following object is masked from 'package:utils':
## 
##     findMatches

## The following objects are masked from 'package:base':
## 
##     expand.grid, I, unname

## Loading required package: IRanges

## 
## Attaching package: 'IRanges'

## The following object is masked from 'package:phyloseq':
## 
##     distance

## The following object is masked from 'package:grDevices':
## 
##     windows

## Loading required package: XVector

## Loading required package: GenomeInfoDb

## 
## Attaching package: 'Biostrings'

## The following object is masked from 'package:base':
## 
##     strsplit
samples.out <- rownames(seqtab.nochim)
subject <- sapply(strsplit(samples.out, "D"), `[`, 1)
gender <- substr(subject,1,1)
subject <- substr(subject,2,999)
txt <- sapply(strsplit(samples.out, "D"), `[`, 2)
txt <- sapply(strsplit(txt, "_"), `[`, 1)
day <- as.integer(txt)
samdf <- data.frame(Subject=subject, Gender=gender, Day=day)
samdf$When <- "Early"
samdf$When[samdf$Day>100] <- "Late"
rownames(samdf) <- samples.out
samdf
##                                    Subject Gender Day  When
## F3D0_F_filt.fastq.gz                     3      F   0 Early
## F3D1_F_filt.fastq.gz                     3      F   1 Early
## F3D141_F_filt.fastq.gz                   3      F 141  Late
## F3D142_F_filt.fastq.gz                   3      F 142  Late
## F3D143_F_filt.fastq.gz                   3      F 143  Late
## F3D144_F_filt.fastq.gz                   3      F 144  Late
## F3D145_F_filt.fastq.gz                   3      F 145  Late
## F3D146_F_filt.fastq.gz                   3      F 146  Late
## F3D147_F_filt.fastq.gz                   3      F 147  Late
## F3D148_F_filt.fastq.gz                   3      F 148  Late
## F3D149_F_filt.fastq.gz                   3      F 149  Late
## F3D150_F_filt.fastq.gz                   3      F 150  Late
## F3D2_F_filt.fastq.gz                     3      F   2 Early
## F3D3_F_filt.fastq.gz                     3      F   3 Early
## F3D5_F_filt.fastq.gz                     3      F   5 Early
## F3D6_F_filt.fastq.gz                     3      F   6 Early
## F3D7_F_filt.fastq.gz                     3      F   7 Early
## F3D8_F_filt.fastq.gz                     3      F   8 Early
## F3D9_F_filt.fastq.gz                     3      F   9 Early
## Mock_F_filt.fastq.gz   ock_F_filt.fastq.gz      M  NA Early
ps <- phyloseq(otu_table(seqtab.nochim, taxa_are_rows=FALSE), 
               sample_data(samdf), 
               tax_table(taxa))
ps <- prune_samples(!grepl("ock", sample_names(ps)), ps) # Remove mock sample
sample_names(ps)
##  [1] "F3D0_F_filt.fastq.gz"   "F3D1_F_filt.fastq.gz"   "F3D141_F_filt.fastq.gz"
##  [4] "F3D142_F_filt.fastq.gz" "F3D143_F_filt.fastq.gz" "F3D144_F_filt.fastq.gz"
##  [7] "F3D145_F_filt.fastq.gz" "F3D146_F_filt.fastq.gz" "F3D147_F_filt.fastq.gz"
## [10] "F3D148_F_filt.fastq.gz" "F3D149_F_filt.fastq.gz" "F3D150_F_filt.fastq.gz"
## [13] "F3D2_F_filt.fastq.gz"   "F3D3_F_filt.fastq.gz"   "F3D5_F_filt.fastq.gz"  
## [16] "F3D6_F_filt.fastq.gz"   "F3D7_F_filt.fastq.gz"   "F3D8_F_filt.fastq.gz"  
## [19] "F3D9_F_filt.fastq.gz"
dna <- Biostrings::DNAStringSet(taxa_names(ps))
names(dna) <- taxa_names(ps)
ps <- merge_phyloseq(ps, dna)
taxa_names(ps) <- paste0("ASV", seq(ntaxa(ps)))
ps
## phyloseq-class experiment-level object
## otu_table()   OTU Table:         [ 232 taxa and 19 samples ]
## sample_data() Sample Data:       [ 19 samples by 4 sample variables ]
## tax_table()   Taxonomy Table:    [ 232 taxa by 6 taxonomic ranks ]
## refseq()      DNAStringSet:      [ 232 reference sequences ]
plot_richness(ps, x="Day", measures=c("Shannon", "Simpson"), color="When")
## Warning in estimate_richness(physeq, split = TRUE, measures = measures): The data you have provided does not have
## any singletons. This is highly suspicious. Results of richness
## estimates (for example) are probably unreliable, or wrong, if you have already
## trimmed low-abundance taxa from the data.
## 
## We recommended that you find the un-trimmed data and retry.

ps.prop <- transform_sample_counts(ps, function(otu) otu/sum(otu))
# Transformed otu sample counts into proportions
ord.nmds.bray <- ordinate(ps.prop, method="NMDS", distance="bray")
## Run 0 stress 0.08043117 
## Run 1 stress 0.1010632 
## Run 2 stress 0.08076339 
## ... Procrustes: rmse 0.01054253  max resid 0.03245376 
## Run 3 stress 0.1010632 
## Run 4 stress 0.09477222 
## Run 5 stress 0.08616061 
## Run 6 stress 0.08076339 
## ... Procrustes: rmse 0.01054616  max resid 0.03246546 
## Run 7 stress 0.08043117 
## ... Procrustes: rmse 1.13206e-06  max resid 3.011207e-06 
## ... Similar to previous best
## Run 8 stress 0.1212044 
## Run 9 stress 0.1326152 
## Run 10 stress 0.0807634 
## ... Procrustes: rmse 0.01056416  max resid 0.032524 
## Run 11 stress 0.08616061 
## Run 12 stress 0.1212044 
## Run 13 stress 0.1212044 
## Run 14 stress 0.08616061 
## Run 15 stress 0.08076339 
## ... Procrustes: rmse 0.0105491  max resid 0.03247491 
## Run 16 stress 0.08043117 
## ... Procrustes: rmse 1.312589e-06  max resid 3.150206e-06 
## ... Similar to previous best
## Run 17 stress 0.08076338 
## ... Procrustes: rmse 0.01050367  max resid 0.03232619 
## Run 18 stress 0.08616061 
## Run 19 stress 0.08616061 
## Run 20 stress 0.1228545 
## *** Best solution repeated 2 times
sample_data(ps.prop)$filename = factor(rownames(sample_data(ps.prop)))
plot_ordination(ps.prop, ord.nmds.bray, color="When", title="Bray NMDS") +
  geom_text(
    label=rownames(sample_data(ps.prop)), 
    nudge_x = 0.25, nudge_y = 0.25, 
    check_overlap = T
  )

# filter the top 20 most existing taxa
top20 <- names(sort(taxa_sums(ps), decreasing=TRUE))[1:20]
ps.top20 <- transform_sample_counts(ps, function(OTU) OTU/sum(OTU))
ps.top20 <- prune_taxa(top20, ps.top20)
plot_bar(ps.top20, x="Day", fill="Family") + facet_wrap(~When, scales="free_x")