Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Trying to use SSpace-Long Read #70

Open
subnandakumar opened this issue Jan 24, 2017 · 1 comment
Open

Trying to use SSpace-Long Read #70

subnandakumar opened this issue Jan 24, 2017 · 1 comment

Comments

@subnandakumar
Copy link

subnandakumar commented Jan 24, 2017

I have pre-assembled contigs from Canu.

When I run the script: It gives me an error: Please insert a file with contig sequences. You've inserted '/SSPACE/SSPACE-LongRead_v1-1/runs/data/contigs.fasta' which either does not exist or is not filled in

However this is a file that consists all the. contigs.

Eg of header:

tig00000001 len=1248915 reads=5062 covStat=1331.73 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
TACTAAGCTCCTTACTAGAGGCATCATAATATTATCCCTTTACCTATTAGCATAAGTCTTATTCTTCATTCTTCTACAAAAACCTAAACCATCCAAAAAT

@jacquikeane
Copy link

Could you provide us with the exact command that you ran?

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

2 participants