From cfe82532f6f5251ad821c48de717cdd4c958d08e Mon Sep 17 00:00:00 2001 From: Florian Wuennemann Date: Wed, 26 Jun 2024 16:34:08 +0000 Subject: [PATCH 01/70] Replaced local unicycler module with nf-core module. --- conf/test.config | 2 +- modules.json | 5 + modules/nf-core/unicycler/environment.yml | 7 ++ modules/nf-core/unicycler/main.nf | 61 ++++++++++ modules/nf-core/unicycler/meta.yml | 64 +++++++++++ modules/nf-core/unicycler/tests/main.nf.test | 61 ++++++++++ .../nf-core/unicycler/tests/main.nf.test.snap | 104 ++++++++++++++++++ modules/nf-core/unicycler/tests/tags.yml | 2 + workflows/bacass.nf | 2 +- 9 files changed, 306 insertions(+), 2 deletions(-) create mode 100644 modules/nf-core/unicycler/environment.yml create mode 100644 modules/nf-core/unicycler/main.nf create mode 100644 modules/nf-core/unicycler/meta.yml create mode 100644 modules/nf-core/unicycler/tests/main.nf.test create mode 100644 modules/nf-core/unicycler/tests/main.nf.test.snap create mode 100644 modules/nf-core/unicycler/tests/tags.yml diff --git a/conf/test.config b/conf/test.config index 0b422f03..ad3ac83f 100644 --- a/conf/test.config +++ b/conf/test.config @@ -23,7 +23,7 @@ params { input = params.pipelines_testdata_base_path + 'bacass/bacass_short.tsv' // some extra args to speed tests up - unicycler_args = "--no_correct --no_pilon" + unicycler_args = "" prokka_args = " --fast" assembly_type = 'short' skip_pycoqc = true diff --git a/modules.json b/modules.json index 6dc814ab..90f84138 100644 --- a/modules.json +++ b/modules.json @@ -92,6 +92,11 @@ "git_sha": "4352dbdb09ec40db71e9b172b97a01dcf5622c26", "installed_by": ["modules"] }, + "unicycler": { + "branch": "master", + "git_sha": "5f65b5398f3fe4b8d51d77ed90b0a8cd8c89bba7", + "installed_by": ["modules"] + }, "untar": { "branch": "master", "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", diff --git a/modules/nf-core/unicycler/environment.yml b/modules/nf-core/unicycler/environment.yml new file mode 100644 index 00000000..ffe491b8 --- /dev/null +++ b/modules/nf-core/unicycler/environment.yml @@ -0,0 +1,7 @@ +name: unicycler +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::unicycler=0.5.0 diff --git a/modules/nf-core/unicycler/main.nf b/modules/nf-core/unicycler/main.nf new file mode 100644 index 00000000..f8971804 --- /dev/null +++ b/modules/nf-core/unicycler/main.nf @@ -0,0 +1,61 @@ +process UNICYCLER { + tag "$meta.id" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/unicycler:0.5.0--py312hc60241a_5' : + 'biocontainers/unicycler:0.5.0--py312hc60241a_5' }" + + input: + tuple val(meta), path(shortreads), path(longreads) + + output: + tuple val(meta), path('*.scaffolds.fa.gz'), emit: scaffolds + tuple val(meta), path('*.assembly.gfa.gz'), emit: gfa + tuple val(meta), path('*.log') , emit: log + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def short_reads = shortreads ? ( meta.single_end ? "-s $shortreads" : "-1 ${shortreads[0]} -2 ${shortreads[1]}" ) : "" + def long_reads = longreads ? "-l $longreads" : "" + """ + unicycler \\ + --threads $task.cpus \\ + $args \\ + $short_reads \\ + $long_reads \\ + --out ./ + + mv assembly.fasta ${prefix}.scaffolds.fa + gzip -n ${prefix}.scaffolds.fa + mv assembly.gfa ${prefix}.assembly.gfa + gzip -n ${prefix}.assembly.gfa + mv unicycler.log ${prefix}.unicycler.log + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + unicycler: \$(echo \$(unicycler --version 2>&1) | sed 's/^.*Unicycler v//; s/ .*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + + cat "" | gzip > ${prefix}.scaffolds.fa.gz + cat "" | gzip > ${prefix}.assembly.gfa.gz + touch ${prefix}.unicycler.log + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + unicycler: \$(echo \$(unicycler --version 2>&1) | sed 's/^.*Unicycler v//; s/ .*\$//') + END_VERSIONS + """ + +} diff --git a/modules/nf-core/unicycler/meta.yml b/modules/nf-core/unicycler/meta.yml new file mode 100644 index 00000000..406b1470 --- /dev/null +++ b/modules/nf-core/unicycler/meta.yml @@ -0,0 +1,64 @@ +name: unicycler +description: Assembles bacterial genomes +keywords: + - genome + - assembly + - genome assembler + - small genome +tools: + - unicycler: + description: Hybrid assembly pipeline for bacterial genomes + homepage: https://github.com/rrwick/Unicycler + documentation: https://github.com/rrwick/Unicycler + tool_dev_url: https://github.com/rrwick/Unicycler + doi: 10.1371/journal.pcbi.1005595 + licence: ["GPL v3"] +input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - shortreads: + type: file + description: | + List of input Illumina FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. + - longreads: + type: file + description: | + List of input FastQ files of size 1, PacBio or Nanopore long reads. +output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" + - scaffolds: + type: file + description: Fasta file containing scaffolds + pattern: "*.{scaffolds.fa.gz}" + - gfa: + type: file + description: gfa file containing assembly + pattern: "*.{assembly.gfa.gz}" + - log: + type: file + description: unicycler log file + pattern: "*.{log}" + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@JoseEspinosa" + - "@drpatelh" + - "@d4straub" +maintainers: + - "@JoseEspinosa" + - "@drpatelh" + - "@d4straub" diff --git a/modules/nf-core/unicycler/tests/main.nf.test b/modules/nf-core/unicycler/tests/main.nf.test new file mode 100644 index 00000000..416b50b8 --- /dev/null +++ b/modules/nf-core/unicycler/tests/main.nf.test @@ -0,0 +1,61 @@ +nextflow_process { + + name "Test Process UNICYCLER" + script "../main.nf" + process "UNICYCLER" + + tag "modules" + tag "modules_nfcore" + tag "unicycler" + + test("bacteroides_fragilis - nanopore") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [], + [ file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/nanopore/fastq/test.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.scaffolds, + process.out.gfa, + file(process.out.log.get(0).get(1)).name, + process.out.versions).match() + } + ) + } + } + + test("bacteroides_fragilis - nanopore - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [], + [ file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/nanopore/fastq/test.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() + } + ) + } + } + +} diff --git a/modules/nf-core/unicycler/tests/main.nf.test.snap b/modules/nf-core/unicycler/tests/main.nf.test.snap new file mode 100644 index 00000000..4e627b39 --- /dev/null +++ b/modules/nf-core/unicycler/tests/main.nf.test.snap @@ -0,0 +1,104 @@ +{ + "bacteroides_fragilis - nanopore": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.scaffolds.fa.gz:md5,8f2b98020361b047eec9dc4c23792d37" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.assembly.gfa.gz:md5,849cec81b0ebf8b34554cf56ce0939d2" + ] + ], + "test.unicycler.log", + [ + "versions.yml:md5,3a81549d1e874ec0214fd1a08384b8b5" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-18T18:40:42.723547744" + }, + "bacteroides_fragilis - nanopore - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.scaffolds.fa.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.assembly.gfa.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.unicycler.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,3a81549d1e874ec0214fd1a08384b8b5" + ], + "gfa": [ + [ + { + "id": "test", + "single_end": true + }, + "test.assembly.gfa.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.unicycler.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "scaffolds": [ + [ + { + "id": "test", + "single_end": true + }, + "test.scaffolds.fa.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3a81549d1e874ec0214fd1a08384b8b5" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-18T18:40:59.5110618" + } +} \ No newline at end of file diff --git a/modules/nf-core/unicycler/tests/tags.yml b/modules/nf-core/unicycler/tests/tags.yml new file mode 100644 index 00000000..25b2cf28 --- /dev/null +++ b/modules/nf-core/unicycler/tests/tags.yml @@ -0,0 +1,2 @@ +unicycler: + - "modules/nf-core/unicycler/**" diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 448d0cbc..faa9524b 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -27,7 +27,7 @@ for (param in checkPathParamList) { if (param) { file(param, checkIfExists: true // MODULE: Local to the pipeline // include { PYCOQC } from '../modules/local/pycoqc' -include { UNICYCLER } from '../modules/local/unicycler' +include { UNICYCLER } from '../modules/nf-core/unicycler/main' include { NANOPOLISH } from '../modules/local/nanopolish' include { MEDAKA } from '../modules/local/medaka' include { KRAKEN2_DB_PREPARATION } from '../modules/local/kraken2_db_preparation' From 24f0cbc74ab8782db1e15a29fc49429324c542bc Mon Sep 17 00:00:00 2001 From: Florian Wuennemann Date: Thu, 27 Jun 2024 14:09:09 +0000 Subject: [PATCH 02/70] Removed deprecated unicycler parameters from test_dfast. --- conf/test.config | 1 - conf/test_dfast.config | 1 - 2 files changed, 2 deletions(-) diff --git a/conf/test.config b/conf/test.config index ad3ac83f..90115dad 100644 --- a/conf/test.config +++ b/conf/test.config @@ -23,7 +23,6 @@ params { input = params.pipelines_testdata_base_path + 'bacass/bacass_short.tsv' // some extra args to speed tests up - unicycler_args = "" prokka_args = " --fast" assembly_type = 'short' skip_pycoqc = true diff --git a/conf/test_dfast.config b/conf/test_dfast.config index 9edc4a7e..e2d0afe2 100644 --- a/conf/test_dfast.config +++ b/conf/test_dfast.config @@ -23,7 +23,6 @@ params { input = params.pipelines_testdata_base_path + 'bacass/bacass_short.tsv' // some extra args to speed tests up - unicycler_args = "--no_correct --no_pilon" annotation_tool = 'dfast' assembly_type = 'short' skip_pycoqc = true From 2baeb3b7c53f2642e44d9a99bd56463f952fbb4b Mon Sep 17 00:00:00 2001 From: Florian Wuennemann Date: Thu, 27 Jun 2024 14:18:51 +0000 Subject: [PATCH 03/70] Updated CHANGELOG. --- CHANGELOG.md | 14 ++++++++++++++ 1 file changed, 14 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 4d476ac6..21eaa7fb 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,6 +3,20 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). +## v2.4.0 nf-core/bacass + +### `Changed` + +- [#150](https://github.com/nf-core/bacass/pull/150) Replace local unicycler module with nf-core module + bump version + +### `Added` + +### `Fixed` + +### `Dependencies` + +### `Deprecated` + ## v2.3.1 nf-core/bacass: "Navy Iron Oyster" 2024/06/24 ### `Changed` From e9228123f49651f663632799177b39067cfb639c Mon Sep 17 00:00:00 2001 From: Florian Wuennemann Date: Thu, 27 Jun 2024 15:38:47 +0000 Subject: [PATCH 04/70] Removed no longer needed unicycler local files. --- modules/local/unicycler/environment.yml | 7 ---- modules/local/unicycler/main.nf | 50 ------------------------- 2 files changed, 57 deletions(-) delete mode 100644 modules/local/unicycler/environment.yml delete mode 100644 modules/local/unicycler/main.nf diff --git a/modules/local/unicycler/environment.yml b/modules/local/unicycler/environment.yml deleted file mode 100644 index 9e32bbc5..00000000 --- a/modules/local/unicycler/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: unicycler -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - unicycler=0.4.8 diff --git a/modules/local/unicycler/main.nf b/modules/local/unicycler/main.nf deleted file mode 100644 index eea72381..00000000 --- a/modules/local/unicycler/main.nf +++ /dev/null @@ -1,50 +0,0 @@ -process UNICYCLER { - tag "$meta.id" - label 'process_high' - - conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/unicycler:0.4.8--py38h8162308_3' : - 'biocontainers/unicycler:0.4.8--py38h8162308_3' }" - - input: - tuple val(meta), path(shortreads), path(longreads) - - output: - tuple val(meta), path('*.scaffolds.fa.gz'), emit: scaffolds - tuple val(meta), path('*.assembly.gfa.gz'), emit: gfa - tuple val(meta), path('*.log') , emit: log - path "versions.yml" , emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - if(params.assembly_type == 'long'){ - input_reads = "-l $longreads" - } else if (params.assembly_type == 'short'){ - input_reads = "-1 ${shortreads[0]} -2 ${shortreads[1]}" - } else if (params.assembly_type == 'hybrid'){ - input_reads = "-1 ${shortreads[0]} -2 ${shortreads[1]} -l $longreads" - } - """ - unicycler \\ - --threads $task.cpus \\ - $args \\ - $input_reads \\ - --out ./ - - mv assembly.fasta ${prefix}.scaffolds.fa - gzip -n ${prefix}.scaffolds.fa - mv assembly.gfa ${prefix}.assembly.gfa - gzip -n ${prefix}.assembly.gfa - mv unicycler.log ${prefix}.unicycler.log - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - unicycler: \$(echo \$(unicycler --version 2>&1) | sed 's/^.*Unicycler v//; s/ .*\$//') - END_VERSIONS - """ -} From a49930e40a6bfdf05f52d86849a43c113fbf9cd0 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 10 Jul 2024 12:15:18 +0200 Subject: [PATCH 05/70] fix missing dev tag in bumped version --- CHANGELOG.md | 2 +- assets/multiqc_config.yml | 4 ++-- nextflow.config | 2 +- 3 files changed, 4 insertions(+), 4 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 21eaa7fb..02daaed6 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v2.4.0 nf-core/bacass +## v2.4.0dev nf-core/bacass ### `Changed` diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index 95b5ae9b..e647ad5a 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,7 +1,7 @@ report_comment: > - This report has been generated by the nf-core/bacass + This report has been generated by the nf-core/bacass analysis pipeline. For information about how to interpret these results, please see the - documentation. + documentation. report_section_order: "nf-core-bacass-methods-description": order: -1000 diff --git a/nextflow.config b/nextflow.config index 3935924e..ad407563 100644 --- a/nextflow.config +++ b/nextflow.config @@ -278,7 +278,7 @@ manifest { description = """Simple bacterial assembly and annotation""" mainScript = 'main.nf' nextflowVersion = '!>=23.04.0' - version = '2.3.1' + version = '2.4.0dev' doi = '10.5281/zenodo.2669428' } From 04091a32dca2e89cf4387ec3c0a22ebd7574425d Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 10 Jul 2024 13:36:51 +0200 Subject: [PATCH 06/70] remove files_unchanged items form linting --- .nf-core.yml | 3 --- 1 file changed, 3 deletions(-) diff --git a/.nf-core.yml b/.nf-core.yml index 216c3138..0b077e6d 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -2,9 +2,6 @@ repository_type: pipeline lint: files_exist: - conf/igenomes.config - files_unchanged: - - .github/CONTRIBUTING.md - - .github/PULL_REQUEST_TEMPLATE.md nextflow_config: - config_defaults: - params.dfast_config From 1bb32782bc0ec76ade0c950d0ea98c22dd8bc3f8 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 10 Jul 2024 13:39:13 +0200 Subject: [PATCH 07/70] fix files_unchanged to make a proper linting check --- .github/CONTRIBUTING.md | 14 +++++--------- .github/PULL_REQUEST_TEMPLATE.md | 1 + 2 files changed, 6 insertions(+), 9 deletions(-) diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index e96ce769..24edde80 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -26,7 +26,11 @@ If you're not used to this workflow with git, you can start with some [docs from ## Tests -You have the option to test your changes locally by running the pipeline. For receiving warnings about process selectors and other `debug` information, it is recommended to use the debug profile. +You have the option to test your changes locally by running the pipeline. For receiving warnings about process selectors and other `debug` information, it is recommended to use the debug profile. Execute all the tests with the following command: + +```bash +nf-test test --profile debug,test,docker --verbose +``` When you create a pull request with changes, [GitHub Actions](https://github.com/features/actions) will run automatic tests. Typically, pull-requests are only fully reviewed when these tests are passing, though of course we can help out before then. @@ -47,14 +51,6 @@ Each `nf-core` pipeline should be set up with a minimal set of test-data. If there are any failures then the automated tests fail. These tests are run both with the latest available version of `Nextflow` and also the minimum required version that is stated in the pipeline code. -You can run pipeline tests with the following command: - -```bash -nextflow run nf-core/bacass \ - -profile , \ - --outdir -``` - ## Patch :warning: Only in the unlikely and regretful event of a release happening with a bug. diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 73441108..99d5b0f0 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -19,6 +19,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/baca - [ ] If necessary, also make a PR on the nf-core/bacass _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. - [ ] Make sure your code lints (`nf-core lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). +- [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. - [ ] Output Documentation in `docs/output.md` is updated. - [ ] `CHANGELOG.md` is updated. From b73c536630edbbfbf0226eef9c8fe2d2f76f4789 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 10 Jul 2024 13:47:01 +0200 Subject: [PATCH 08/70] added changelog #153 --- CHANGELOG.md | 2 ++ 1 file changed, 2 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 02daaed6..6a24efb4 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -13,6 +13,8 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#153](https://github.com/nf-core/bacass/pull/153) Update `.nf-core.yml` to fix files_unchanged section for accurate linting checks. + ### `Dependencies` ### `Deprecated` From e8442e2d8b3470e5da74a16524cbb4e811c01c4c Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 10 Jul 2024 11:12:56 +0200 Subject: [PATCH 09/70] fix kmerfinder script to download reference --- bin/download_reference.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bin/download_reference.py b/bin/download_reference.py index 88e89364..2c09cb83 100755 --- a/bin/download_reference.py +++ b/bin/download_reference.py @@ -122,7 +122,7 @@ def download_references(file, reference, out_dir): ref_query = f"{assembly_accession}_{asm_name}" # Check if ref_query matches the search value - if ref_query == top_reference: + if top_reference in ref_query: # make url # Append the 20th element of the row to the URL list: assembly_url = row[19] + "/" + ref_query dir_url.append(assembly_url) From 3bfab1518f823f1af78dc1976d4c32d01cc6bf39 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 10 Jul 2024 11:13:27 +0200 Subject: [PATCH 10/70] add more resources to kmerfinder module to avoid memory related issues --- modules/local/kmerfinder.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/modules/local/kmerfinder.nf b/modules/local/kmerfinder.nf index cca5f359..66a48f1e 100644 --- a/modules/local/kmerfinder.nf +++ b/modules/local/kmerfinder.nf @@ -1,6 +1,6 @@ process KMERFINDER { tag "$meta.id" - label 'process_medium' + label 'process_high' conda "bioconda::kmerfinder=3.0.2" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? From 3e9cf3f521c6f4cae8cfbe4250887d8be770664f Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 10 Jul 2024 15:19:28 +0200 Subject: [PATCH 11/70] added changelog #154 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 6a24efb4..583e1d82 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -13,6 +13,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#154](https://github.com/nf-core/bacass/pull/154) Fixed kmerfinder script and increase resources to prevent memory issues. - [#153](https://github.com/nf-core/bacass/pull/153) Update `.nf-core.yml` to fix files_unchanged section for accurate linting checks. ### `Dependencies` From 084fec4984fa0d71032931ea15f55fc924a6ea36 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 29 Aug 2024 10:09:03 +0200 Subject: [PATCH 12/70] fixed current zenodo url to kmerfinderdb --- conf/test_full.config | 2 +- modules/local/kmerfinder.nf | 11 +++++++---- nextflow_schema.json | 4 ++-- subworkflows/local/kmerfinder_subworkflow.nf | 3 ++- 4 files changed, 12 insertions(+), 8 deletions(-) diff --git a/conf/test_full.config b/conf/test_full.config index f51aa6d5..f3dc621c 100644 --- a/conf/test_full.config +++ b/conf/test_full.config @@ -17,6 +17,6 @@ params { // Input data for full size test input = params.pipelines_testdata_base_path + 'bacass/bacass_full.tsv' kraken2db = 'https://genome-idx.s3.amazonaws.com/kraken/k2_standard_8gb_20210517.tar.gz' - kmerfinderdb = 'https://zenodo.org/records/10458361/files/20190108_kmerfinder_stable_dirs.tar.gz' + kmerfinderdb = 'https://zenodo.org/records/13447056/files/20190108_kmerfinder_stable_dirs.tar.gz' ncbi_assembly_metadata = 'https://ftp.ncbi.nlm.nih.gov/genomes/ASSEMBLY_REPORTS/assembly_summary_refseq.txt' } diff --git a/modules/local/kmerfinder.nf b/modules/local/kmerfinder.nf index 66a48f1e..38532de6 100644 --- a/modules/local/kmerfinder.nf +++ b/modules/local/kmerfinder.nf @@ -8,7 +8,8 @@ process KMERFINDER { 'biocontainers/kmerfinder:3.0.2--hdfd78af_0' }" input: - tuple val(meta), path(reads), path(kmerfinder_db) + tuple val(meta), path(reads), path(kmerfinderdb_path) + val tax_group output: tuple val(meta), path("*_results.txt") , emit: report @@ -18,14 +19,15 @@ process KMERFINDER { script: def prefix = task.ext.prefix ?: "${meta.id}" def in_reads = reads[0] && reads[1] ? "${reads[0]} ${reads[1]}" : "${reads}" - // WARNING: Ensure to update software version in this line if you modify the container/environment. + // WARNING: Ensure to update software or database version in this line if you modify the container/environment. def kmerfinder_version = "3.0.2" + def kmerfinderdb_version = "20190108" """ kmerfinder.py \\ --infile $in_reads \\ --output_folder . \\ - --db_path ${kmerfinder_db}/bacteria.ATG \\ - -tax ${kmerfinder_db}/bacteria.name \\ + --db_path ${kmerfinderdb_path}/${tax_group}/bacteria.ATG \\ + -tax ${kmerfinderdb_path}/${tax_group}/bacteria.name \\ -x mv results.txt ${prefix}_results.txt @@ -34,6 +36,7 @@ process KMERFINDER { cat <<-END_VERSIONS > versions.yml "${task.process}": kmerfinder: \$(echo "${kmerfinder_version}") + kmerfinderdb: \$(echo "${kmerfinderdb_version}") END_VERSIONS """ } diff --git a/nextflow_schema.json b/nextflow_schema.json index 8eec0004..c5dc6ceb 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -83,7 +83,7 @@ }, "kmerfinderdb": { "type": "string", - "description": "Path to the Kmerfinder bacteria database. For more details, see [Kmerfinder Databases](https://bitbucket.org/genomicepidemiology/kmerfinder_db/src/master/). You can also download precomputed Kmerfinder database (dated 2019/01/08) from https://zenodo.org/records/10458361/files/20190108_kmerfinder_stable_dirs.tar.gz " + "description": "Path to the Kmerfinder bacteria database. For more details, see [Kmerfinder Databases](https://bitbucket.org/genomicepidemiology/kmerfinder_db/src/master/). You can also download precomputed Kmerfinder database (dated 2019/01/08) from https://zenodo.org/records/13447056/files/20190108_kmerfinder_stable_dirs.tar.gz" }, "reference_fasta": { "type": "string", @@ -95,7 +95,7 @@ }, "ncbi_assembly_metadata": { "type": "string", - "description": "Master file (*.txt) containing a summary of assemblies available in GeneBank or RefSeq. See: https://ftp.ncbi.nlm.nih.gov/genomes/README_assembly_summary.txt" + "description": "Master file (*.txt) containing a summary of assemblies available in GeneBank or RefSeq. See: https://ftp.ncbi.nlm.nih.gov/genomes/ASSEMBLY_REPORTS/assembly_summary_refseq.txt" } } }, diff --git a/subworkflows/local/kmerfinder_subworkflow.nf b/subworkflows/local/kmerfinder_subworkflow.nf index ef777ebc..9b27f085 100644 --- a/subworkflows/local/kmerfinder_subworkflow.nf +++ b/subworkflows/local/kmerfinder_subworkflow.nf @@ -33,7 +33,8 @@ workflow KMERFINDER_SUBWORKFLOW { .set{ ch_to_kmerfinder } KMERFINDER ( - ch_to_kmerfinder + ch_to_kmerfinder, // Channel: [ meta, reads, path_to_kmerfinderdb ] + 'bacteria' // Val: 'tax_group' ) ch_kmerfinder_report = KMERFINDER.out.report ch_kmerfinder_json = KMERFINDER.out.json From 82adb62370621390050d19370ae2d0f681e63a32 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 29 Aug 2024 10:20:04 +0200 Subject: [PATCH 13/70] update changelog in #157 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 583e1d82..7c1b9b17 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -13,6 +13,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#157](https://github.com/nf-core/bacass/pull/157) Fixed corrupted zenodo URL of Kmerfinder database. - [#154](https://github.com/nf-core/bacass/pull/154) Fixed kmerfinder script and increase resources to prevent memory issues. - [#153](https://github.com/nf-core/bacass/pull/153) Update `.nf-core.yml` to fix files_unchanged section for accurate linting checks. From 04def18c8d2669a9dbeccfd3c4621edca83b6efd Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 29 Aug 2024 11:53:14 +0200 Subject: [PATCH 14/70] enhance KmerFinder support parsing multiple file format versions --- modules/local/kmerfinder.nf | 8 +++++--- 1 file changed, 5 insertions(+), 3 deletions(-) diff --git a/modules/local/kmerfinder.nf b/modules/local/kmerfinder.nf index 38532de6..18a0f521 100644 --- a/modules/local/kmerfinder.nf +++ b/modules/local/kmerfinder.nf @@ -19,15 +19,17 @@ process KMERFINDER { script: def prefix = task.ext.prefix ?: "${meta.id}" def in_reads = reads[0] && reads[1] ? "${reads[0]} ${reads[1]}" : "${reads}" - // WARNING: Ensure to update software or database version in this line if you modify the container/environment. + def dbpath_file = file("${kmerfinder_db}/bacteria/bacteria.ATG").exists() ?: "${kmerfinder_db}/bacteria/bacteria.ATG" + def tax_file = file("${kmerfinder_db}/bacteria/bacteria.name").exists() ? "${kmerfinder_db}/bacteria/bacteria.name" : "${kmerfinder_db}/bacteria/bacteria.tax" + // WARNING: Ensure to update software version in this line if you modify the container/environment. def kmerfinder_version = "3.0.2" def kmerfinderdb_version = "20190108" """ kmerfinder.py \\ --infile $in_reads \\ --output_folder . \\ - --db_path ${kmerfinderdb_path}/${tax_group}/bacteria.ATG \\ - -tax ${kmerfinderdb_path}/${tax_group}/bacteria.name \\ + --db_path $dbpath_file \\ + -tax $tax_file \\ -x mv results.txt ${prefix}_results.txt From 9280f8975a8b3e92929923c53a66edaeb0ab761c Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 29 Aug 2024 15:50:16 +0200 Subject: [PATCH 15/70] update kmerfinderdb description --- nextflow_schema.json | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/nextflow_schema.json b/nextflow_schema.json index c5dc6ceb..e7dfb12f 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -83,7 +83,7 @@ }, "kmerfinderdb": { "type": "string", - "description": "Path to the Kmerfinder bacteria database. For more details, see [Kmerfinder Databases](https://bitbucket.org/genomicepidemiology/kmerfinder_db/src/master/). You can also download precomputed Kmerfinder database (dated 2019/01/08) from https://zenodo.org/records/13447056/files/20190108_kmerfinder_stable_dirs.tar.gz" + "description": "Path to the Kmerfinder bacteria database. See database installation (guidelines)[https://bitbucket.org/genomicepidemiology/kmerfinder_db/src/master/] for details. The latest version can be downloaded from the KmerFinder Database FTP site or directly during pipeline execution with. Example:\n\n```--kmerfinder_db 'ftp://ftp.cbs.dtu.dk/public/CGE/databases/KmerFinder/version/latest/bacteria.tar.gz'```\n(Note: Downloading the KmerFinder database (~30GB) via FTP can be time-consuming. It's recommended to pre-download the database and provide the *.tar.gz file using this parameter instead of URL site.).\nAn older version is available on (Zenodo)[https://zenodo.org/records/13447056/files/20190108_kmerfinder_stable_dirs.tar.gz]." }, "reference_fasta": { "type": "string", From b5b0407ff1e18e0cc8a82214f36d50c4746882fe Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 30 Aug 2024 15:52:41 +0200 Subject: [PATCH 16/70] update kmerfinder module --- modules/local/kmerfinder.nf | 10 ++++------ nextflow_schema.json | 2 +- 2 files changed, 5 insertions(+), 7 deletions(-) diff --git a/modules/local/kmerfinder.nf b/modules/local/kmerfinder.nf index 18a0f521..0159e742 100644 --- a/modules/local/kmerfinder.nf +++ b/modules/local/kmerfinder.nf @@ -19,17 +19,16 @@ process KMERFINDER { script: def prefix = task.ext.prefix ?: "${meta.id}" def in_reads = reads[0] && reads[1] ? "${reads[0]} ${reads[1]}" : "${reads}" - def dbpath_file = file("${kmerfinder_db}/bacteria/bacteria.ATG").exists() ?: "${kmerfinder_db}/bacteria/bacteria.ATG" - def tax_file = file("${kmerfinder_db}/bacteria/bacteria.name").exists() ? "${kmerfinder_db}/bacteria/bacteria.name" : "${kmerfinder_db}/bacteria/bacteria.tax" + def db_atg = "${kmerfinderdb_path}/${tax_group}.ATG" + def db_tax = file("${kmerfinderdb_path}/${tax_group}.name").exists() ? "${kmerfinderdb_path}/${tax_group}.name" : "${kmerfinderdb_path}/${tax_group}.tax" // WARNING: Ensure to update software version in this line if you modify the container/environment. def kmerfinder_version = "3.0.2" - def kmerfinderdb_version = "20190108" """ kmerfinder.py \\ --infile $in_reads \\ --output_folder . \\ - --db_path $dbpath_file \\ - -tax $tax_file \\ + --db_path $db_atg \\ + -tax $db_tax \\ -x mv results.txt ${prefix}_results.txt @@ -38,7 +37,6 @@ process KMERFINDER { cat <<-END_VERSIONS > versions.yml "${task.process}": kmerfinder: \$(echo "${kmerfinder_version}") - kmerfinderdb: \$(echo "${kmerfinderdb_version}") END_VERSIONS """ } diff --git a/nextflow_schema.json b/nextflow_schema.json index e7dfb12f..5c40fdd5 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -83,7 +83,7 @@ }, "kmerfinderdb": { "type": "string", - "description": "Path to the Kmerfinder bacteria database. See database installation (guidelines)[https://bitbucket.org/genomicepidemiology/kmerfinder_db/src/master/] for details. The latest version can be downloaded from the KmerFinder Database FTP site or directly during pipeline execution with. Example:\n\n```--kmerfinder_db 'ftp://ftp.cbs.dtu.dk/public/CGE/databases/KmerFinder/version/latest/bacteria.tar.gz'```\n(Note: Downloading the KmerFinder database (~30GB) via FTP can be time-consuming. It's recommended to pre-download the database and provide the *.tar.gz file using this parameter instead of URL site.).\nAn older version is available on (Zenodo)[https://zenodo.org/records/13447056/files/20190108_kmerfinder_stable_dirs.tar.gz]." + "description": "Path to the Kmerfinder bacteria database (ie: '/path_to/kmerfinder/bacteria/ or '/path_to/kmerfinder/bacteria.tar.gz'). Only taxonomic group 'bacteria' is allowed. See database installation (guidelines)[https://bitbucket.org/genomicepidemiology/kmerfinder_db/src/master/] for details. The latest version can be downloaded from the KmerFinder Database FTP site or directly during pipeline execution with. Example:\n\n```--kmerfinder_db 'ftp://ftp.cbs.dtu.dk/public/CGE/databases/KmerFinder/version/latest/bacteria.tar.gz'```\n(Note: Downloading the KmerFinder database (~30GB) via FTP can be time-consuming. It's recommended to pre-download the database and provide the *.tar.gz file using this parameter instead of URL site.).\nAn older version is available on (Zenodo)[https://zenodo.org/records/13447056/files/20190108_kmerfinder_stable_dirs.tar.gz]." }, "reference_fasta": { "type": "string", From fd7dd01eaa5e9a0e1d6450bf53c31e5db6366f95 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 30 Aug 2024 16:01:20 +0200 Subject: [PATCH 17/70] update kmerfinder module dir structure --- modules/local/kmerfinder/environment.yml | 7 +++++++ modules/local/{kmerfinder.nf => kmerfinder/main.nf} | 1 - modules/local/kmerfinder_summary/environment.yml | 7 +++++++ .../{kmerfinder_summary.nf => kmerfinder_summary/main.nf} | 1 - 4 files changed, 14 insertions(+), 2 deletions(-) create mode 100644 modules/local/kmerfinder/environment.yml rename modules/local/{kmerfinder.nf => kmerfinder/main.nf} (97%) create mode 100644 modules/local/kmerfinder_summary/environment.yml rename modules/local/{kmerfinder_summary.nf => kmerfinder_summary/main.nf} (96%) diff --git a/modules/local/kmerfinder/environment.yml b/modules/local/kmerfinder/environment.yml new file mode 100644 index 00000000..bcb28a96 --- /dev/null +++ b/modules/local/kmerfinder/environment.yml @@ -0,0 +1,7 @@ +name: kmerfinder +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::kmerfinder=3.0.2 diff --git a/modules/local/kmerfinder.nf b/modules/local/kmerfinder/main.nf similarity index 97% rename from modules/local/kmerfinder.nf rename to modules/local/kmerfinder/main.nf index 0159e742..cd0b88ec 100644 --- a/modules/local/kmerfinder.nf +++ b/modules/local/kmerfinder/main.nf @@ -2,7 +2,6 @@ process KMERFINDER { tag "$meta.id" label 'process_high' - conda "bioconda::kmerfinder=3.0.2" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/kmerfinder:3.0.2--hdfd78af_0' : 'biocontainers/kmerfinder:3.0.2--hdfd78af_0' }" diff --git a/modules/local/kmerfinder_summary/environment.yml b/modules/local/kmerfinder_summary/environment.yml new file mode 100644 index 00000000..ebf6fb53 --- /dev/null +++ b/modules/local/kmerfinder_summary/environment.yml @@ -0,0 +1,7 @@ +name: kmerfinder_summary +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::multiqc=1.19 diff --git a/modules/local/kmerfinder_summary.nf b/modules/local/kmerfinder_summary/main.nf similarity index 96% rename from modules/local/kmerfinder_summary.nf rename to modules/local/kmerfinder_summary/main.nf index 8e5fe45f..5b222056 100644 --- a/modules/local/kmerfinder_summary.nf +++ b/modules/local/kmerfinder_summary/main.nf @@ -2,7 +2,6 @@ process KMERFINDER_SUMMARY { tag "kmerfinder_summary" label 'process_low' - conda "bioconda::multiqc=1.19" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/multiqc:1.19--pyhdfd78af_0' : 'biocontainers/multiqc:1.19--pyhdfd78af_0' }" From c2a94d7e3a9fb4567b54c6161df74336cdb33680 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 30 Aug 2024 16:23:59 +0200 Subject: [PATCH 18/70] update module paths and handle memory-errors in kmerfinder --- CHANGELOG.md | 1 + conf/modules.config | 4 ++++ modules/local/kmerfinder/main.nf | 2 +- subworkflows/local/kmerfinder_subworkflow.nf | 4 ++-- 4 files changed, 8 insertions(+), 3 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 7c1b9b17..ceda1500 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -7,6 +7,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Changed` +- [#159](https://github.com/nf-core/bacass/pull/159) Updated Kmerfinder module and increased memory. - [#150](https://github.com/nf-core/bacass/pull/150) Replace local unicycler module with nf-core module + bump version ### `Added` diff --git a/conf/modules.config b/conf/modules.config index 78bd92bb..b7516200 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -291,6 +291,10 @@ if (!params.skip_fastp) { if (!params.skip_kmerfinder) { process { withName: '.*:.*:KMERFINDER_SUBWORKFLOW:KMERFINDER' { + errorStrategy = { task.exitStatus in [1, 137, 139] ? 'retry' : 'finish'} + maxRetries = 3 + memory = { task.memory * task.attempt } + ext.args = '' publishDir = [ path: { "${params.outdir}/Kmerfinder/${meta.id}" }, diff --git a/modules/local/kmerfinder/main.nf b/modules/local/kmerfinder/main.nf index cd0b88ec..37439daf 100644 --- a/modules/local/kmerfinder/main.nf +++ b/modules/local/kmerfinder/main.nf @@ -1,6 +1,6 @@ process KMERFINDER { tag "$meta.id" - label 'process_high' + label 'process_medium' container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/kmerfinder:3.0.2--hdfd78af_0' : diff --git a/subworkflows/local/kmerfinder_subworkflow.nf b/subworkflows/local/kmerfinder_subworkflow.nf index 9b27f085..54d4e23c 100644 --- a/subworkflows/local/kmerfinder_subworkflow.nf +++ b/subworkflows/local/kmerfinder_subworkflow.nf @@ -2,8 +2,8 @@ // Kmerfinder subworkflow for species identification & QC // include { UNTAR } from '../../modules/nf-core/untar/main' -include { KMERFINDER } from '../../modules/local/kmerfinder' -include { KMERFINDER_SUMMARY } from '../../modules/local/kmerfinder_summary' +include { KMERFINDER } from '../../modules/local/kmerfinder/main' +include { KMERFINDER_SUMMARY } from '../../modules/local/kmerfinder_summary/main' include { FIND_DOWNLOAD_REFERENCE } from '../../modules/local/find_download_reference' workflow KMERFINDER_SUBWORKFLOW { From 6250ad3b5a13c45a7d2b6ee1c880b0b453bae611 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 3 Sep 2024 11:11:01 +0200 Subject: [PATCH 19/70] fix memory issues due to config in kmerfinder --- conf/modules.config | 1 - 1 file changed, 1 deletion(-) diff --git a/conf/modules.config b/conf/modules.config index b7516200..35248e42 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -293,7 +293,6 @@ if (!params.skip_kmerfinder) { withName: '.*:.*:KMERFINDER_SUBWORKFLOW:KMERFINDER' { errorStrategy = { task.exitStatus in [1, 137, 139] ? 'retry' : 'finish'} maxRetries = 3 - memory = { task.memory * task.attempt } ext.args = '' publishDir = [ From 09a1eb68c69ba6256ea8b12f5d3523a37697ca4b Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 3 Sep 2024 12:06:55 +0200 Subject: [PATCH 20/70] Handle KmerFinder results when no species hit is detected --- subworkflows/local/kmerfinder_subworkflow.nf | 8 ++++++-- 1 file changed, 6 insertions(+), 2 deletions(-) diff --git a/subworkflows/local/kmerfinder_subworkflow.nf b/subworkflows/local/kmerfinder_subworkflow.nf index 54d4e23c..2c0bf70f 100644 --- a/subworkflows/local/kmerfinder_subworkflow.nf +++ b/subworkflows/local/kmerfinder_subworkflow.nf @@ -53,7 +53,9 @@ workflow KMERFINDER_SUBWORKFLOW { .join(consensus, by:0) .map{ meta, report_json, report_txt, fasta -> - specie = report_json.splitJson(path:"kmerfinder.results.species_hits").value.get(0)["Species"] + species_hits = report_json.splitJson(path:"kmerfinder.results.species_hits").value + def specie = species_hits.size() > 0 ? species_hits.get(0)["Species"] : "Unknown Species" + return tuple(specie, meta, report_txt, fasta) } .groupTuple(by:0) // Group by the "Species" field @@ -61,7 +63,9 @@ workflow KMERFINDER_SUBWORKFLOW { // SUBWORKFLOW: For each species target, this subworkflow collects reference genome assemblies ('GCF*') and subsequently downloads the best matching reference assembly. FIND_DOWNLOAD_REFERENCE ( - ch_reports_byreference.map{ specie, meta, report_txt, fasta-> tuple(specie, report_txt) }, + ch_reports_byreference + .map{ specie, meta, report_txt, fasta-> tuple(specie, report_txt) } + .filter{ specie, report_txt -> specie != "Unknown Species" }, ch_ncbi_assembly_metadata ) ch_versions = ch_versions.mix(FIND_DOWNLOAD_REFERENCE.out.versions) From ae525c05e23c1012f19fd7ebf4a461214422b1f5 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 3 Sep 2024 12:07:52 +0200 Subject: [PATCH 21/70] handle prokka/bakkta channel when fasta file is empty --- workflows/bacass.nf | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index faa9524b..df41750d 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -460,7 +460,7 @@ workflow BACASS { ch_versions = ch_versions.mix( GUNZIP.out.versions ) PROKKA ( - ch_to_prokka, + ch_to_prokka.filter{ meta, fasta -> !fasta.isEmpty() }, [], [] ) @@ -479,7 +479,7 @@ workflow BACASS { ch_versions = ch_versions.mix( GUNZIP.out.versions ) BAKTA_DBDOWNLOAD_RUN ( - ch_to_bakta, + ch_to_bakta.filter{ meta, fasta -> !fasta.isEmpty() }, params.baktadb, params.baktadb_download ) From fcf0ab93d0bf3023b6355d2f7f855011382679ae Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 3 Sep 2024 13:46:46 +0200 Subject: [PATCH 22/70] update changelog in #160 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index ceda1500..4ae6d43f 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -14,6 +14,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#160](https://github.com/nf-core/bacass/pull/160) Fixed memory issues in KmerFinder, fixed handling of no species detected, and fixed handling of empty fasta files in the prokka/bakkta channel. - [#157](https://github.com/nf-core/bacass/pull/157) Fixed corrupted zenodo URL of Kmerfinder database. - [#154](https://github.com/nf-core/bacass/pull/154) Fixed kmerfinder script and increase resources to prevent memory issues. - [#153](https://github.com/nf-core/bacass/pull/153) Update `.nf-core.yml` to fix files_unchanged section for accurate linting checks. From 41fd8c9a023f360383f178c09ad54619a2ff9680 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 5 Sep 2024 16:36:55 +0200 Subject: [PATCH 23/70] fix saving merged fastq files in fastp module --- conf/modules.config | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/conf/modules.config b/conf/modules.config index 35248e42..03040514 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -270,6 +270,12 @@ if (!params.skip_fastp) { mode: params.publish_dir_mode, pattern: "*.fail.fastq.gz", enabled: params.save_trimmed_fail + ], + [ + path: { "${params.outdir}/trimming/shortreads" }, + mode: params.publish_dir_mode, + pattern: "*.merged.fastq.gz", + enabled: params.save_merged ] ] } From 7f438ecda52aa6838e9c5692930a9111f3499ddd Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 5 Sep 2024 17:17:43 +0200 Subject: [PATCH 24/70] #163 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 4ae6d43f..5e2ef25e 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -14,6 +14,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#163](https://github.com/nf-core/bacass/pull/163) Fixed `params.save_merged` to properly save merged files - [#160](https://github.com/nf-core/bacass/pull/160) Fixed memory issues in KmerFinder, fixed handling of no species detected, and fixed handling of empty fasta files in the prokka/bakkta channel. - [#157](https://github.com/nf-core/bacass/pull/157) Fixed corrupted zenodo URL of Kmerfinder database. - [#154](https://github.com/nf-core/bacass/pull/154) Fixed kmerfinder script and increase resources to prevent memory issues. From f1f915cb2fc3cc48a8f060d02a9f5ffdf99d8f40 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 6 Sep 2024 13:58:02 +0200 Subject: [PATCH 25/70] extend description on save_merged param --- nextflow_schema.json | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/nextflow_schema.json b/nextflow_schema.json index 5c40fdd5..a058d287 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -56,7 +56,7 @@ }, "save_merged": { "type": "boolean", - "description": "save all merged reads to the a file ending in `*.merged.fastq.gz`" + "description": "save all merged reads to the a file ending in `*.merged.fastq.gz`. This option enables read merging and saves all merged reads to a file ending in `*.merged.fastq.gz`; these reads will be won't be passed to the assembly process." }, "skip_fastqc": { "type": "boolean", From 6e0d781e8ff61135b70d9f674d1ec06c8e103797 Mon Sep 17 00:00:00 2001 From: Daniel VM <69470278+Daniel-VM@users.noreply.github.com> Date: Fri, 6 Sep 2024 14:02:20 +0200 Subject: [PATCH 26/70] Fix CHANGELOG.md #163 Co-authored-by: Jasmin Frangenberg <73216762+jasmezz@users.noreply.github.com> --- CHANGELOG.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 5e2ef25e..ad1c58c3 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -14,7 +14,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` -- [#163](https://github.com/nf-core/bacass/pull/163) Fixed `params.save_merged` to properly save merged files +- [#163](https://github.com/nf-core/bacass/pull/163) Fixed `params.save_merged` to properly save merged files. - [#160](https://github.com/nf-core/bacass/pull/160) Fixed memory issues in KmerFinder, fixed handling of no species detected, and fixed handling of empty fasta files in the prokka/bakkta channel. - [#157](https://github.com/nf-core/bacass/pull/157) Fixed corrupted zenodo URL of Kmerfinder database. - [#154](https://github.com/nf-core/bacass/pull/154) Fixed kmerfinder script and increase resources to prevent memory issues. From 488b5abda410eb0f2de98a0868a1e9cb706698e4 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 13 Sep 2024 17:37:03 +0200 Subject: [PATCH 27/70] append fastqc trim section to multiqc report --- conf/modules.config | 8 ++++++++ modules/local/multiqc_custom.nf | 1 + workflows/bacass.nf | 7 ++++--- 3 files changed, 13 insertions(+), 3 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index 03040514..064f4a27 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -241,6 +241,14 @@ if (!params.skip_fastqc) { saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } + withName: '.*:.*:FASTQ_TRIM_FASTP_FASTQC:FASTQC_TRIM' { + ext.args = '--quiet' + publishDir = [ + path: { "${params.outdir}/FastQC/trim" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename } + ] + } } } if (!params.skip_fastp) { diff --git a/modules/local/multiqc_custom.nf b/modules/local/multiqc_custom.nf index 5c0cc9f5..bc0a8e68 100644 --- a/modules/local/multiqc_custom.nf +++ b/modules/local/multiqc_custom.nf @@ -14,6 +14,7 @@ process MULTIQC_CUSTOM { path methods_description path software_versions path ('fastqc/*') + path ('fastqc_trim/*') path ('fastp/*') path ('nanoplot/*') path ('porechop/*') diff --git a/workflows/bacass.nf b/workflows/bacass.nf index df41750d..3aeb476b 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -127,7 +127,7 @@ workflow BACASS { // ch_fastqc_raw_multiqc = Channel.empty() ch_fastqc_trim_multiqc = Channel.empty() - ch_trim_json_multiqc = Channel.empty() + ch_fastp_json_multiqc = Channel.empty() if (params.assembly_type != 'long'){ FASTQ_TRIM_FASTP_FASTQC ( ch_shortreads, @@ -139,7 +139,7 @@ workflow BACASS { ) ch_fastqc_raw_multiqc = FASTQ_TRIM_FASTP_FASTQC.out.fastqc_raw_zip ch_fastqc_trim_multiqc = FASTQ_TRIM_FASTP_FASTQC.out.fastqc_trim_zip - ch_trim_json_multiqc = FASTQ_TRIM_FASTP_FASTQC.out.trim_json + ch_fastp_json_multiqc = FASTQ_TRIM_FASTP_FASTQC.out.trim_json ch_versions = ch_versions.mix(FASTQ_TRIM_FASTP_FASTQC.out.versions) } @@ -527,7 +527,8 @@ workflow BACASS { ch_multiqc_custom_methods_description.ifEmpty([]), ch_collated_versions.ifEmpty([]), ch_fastqc_raw_multiqc.collect{it[1]}.ifEmpty([]), - ch_trim_json_multiqc.collect{it[1]}.ifEmpty([]), + ch_fastqc_trim_multiqc.collect{it[1]}.ifEmpty([]), + ch_fastp_json_multiqc.collect{it[1]}.ifEmpty([]), ch_nanoplot_txt_multiqc.collect{it[1]}.ifEmpty([]), ch_porechop_log_multiqc.collect{it[1]}.ifEmpty([]), ch_pycoqc_multiqc.collect{it[1]}.ifEmpty([]), From b308a95e28c38c4f2a24a2a319939951877c9856 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 13 Sep 2024 17:37:40 +0200 Subject: [PATCH 28/70] update multiqc config files to arrange preprocessing sections --- assets/multiqc_config.yml | 21 +++++++++++++++++++++ assets/multiqc_config_hybrid.yml | 5 +++++ assets/multiqc_config_short.yml | 5 +++++ 3 files changed, 31 insertions(+) diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index e647ad5a..d1c1e07e 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -2,6 +2,27 @@ report_comment: > This report has been generated by the nf-core/bacass analysis pipeline. For information about how to interpret these results, please see the documentation. + + +max_table_rows: 10000 + +module_order: + - fastqc: + name: "PREPROCESS: FastQC (raw reads)" + info: "This section of the report shows FastQC results for the raw reads before adapter trimming." + path_filters: + - "./fastqc/*.zip" + - fastqc: + name: "PREPROCESS: FastQC (trimmed reads)" + info: "This section of the report shows FastQC results for the processed and trimmed reads." + path_filters: + - "./fastqc_trim/*.zip" + - fastp: + name: "PREPROCESS: fastp (adapter trimming)" + info: "This section of the report shows fastp results for reads after adapter and quality trimming." + path_filters: + - "./fastp/*.json" + report_section_order: "nf-core-bacass-methods-description": order: -1000 diff --git a/assets/multiqc_config_hybrid.yml b/assets/multiqc_config_hybrid.yml index 4c036265..190f5a66 100644 --- a/assets/multiqc_config_hybrid.yml +++ b/assets/multiqc_config_hybrid.yml @@ -28,6 +28,11 @@ module_order: info: "This section of the report shows FastQC results for the raw reads before adapter trimming." path_filters: - "./fastqc/*.zip" + - fastqc: + name: "PREPROCESS: FastQC (trimmed reads)" + info: "This section of the report shows FastQC results for the processed and trimmed reads." + path_filters: + - "./fastqc_trim/*.zip" - fastp: name: "PREPROCESS: fastp (adapter trimming)" info: "This section of the report shows fastp results for reads after adapter and quality trimming." diff --git a/assets/multiqc_config_short.yml b/assets/multiqc_config_short.yml index 2ce2eca6..fdb15636 100644 --- a/assets/multiqc_config_short.yml +++ b/assets/multiqc_config_short.yml @@ -25,6 +25,11 @@ module_order: info: "This section of the report shows FastQC results for the raw reads before adapter trimming." path_filters: - "./fastqc/*.zip" + - fastqc: + name: "PREPROCESS: FastQC (trimmed reads)" + info: "This section of the report shows FastQC results for the processed and trimmed reads." + path_filters: + - "./fastqc_trim/*.zip" - fastp: name: "PREPROCESS: fastp (adapter trimming)" info: "This section of the report shows fastp results for reads after adapter and quality trimming." From 235bf18e1ce327435de5982f767374580e9198f1 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 13 Sep 2024 17:45:43 +0200 Subject: [PATCH 29/70] update changelog #166 --- CHANGELOG.md | 2 ++ 1 file changed, 2 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index ad1c58c3..deb9df01 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -12,6 +12,8 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Added` +- [#166](https://github.com/nf-core/bacass/pull/166) Added FastQC after-trimming section to MultiQC report. + ### `Fixed` - [#163](https://github.com/nf-core/bacass/pull/163) Fixed `params.save_merged` to properly save merged files. From 7842632882d5d805b28daf890e6a9df3decbc17b Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 13 Sep 2024 17:46:10 +0200 Subject: [PATCH 30/70] fix prettier #166 --- assets/multiqc_config.yml | 1 - 1 file changed, 1 deletion(-) diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index d1c1e07e..6f6ef075 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -3,7 +3,6 @@ report_comment: > analysis pipeline. For information about how to interpret these results, please see the documentation. - max_table_rows: 10000 module_order: From 3045163cc61ff7727f1782127d1a6bf3fb02361d Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 10 Sep 2024 16:29:26 +0200 Subject: [PATCH 31/70] remove prams.save_merged from this pipeline --- conf/modules.config | 6 ------ nextflow.config | 1 - nextflow_schema.json | 4 ---- workflows/bacass.nf | 2 +- 4 files changed, 1 insertion(+), 12 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index 064f4a27..03241683 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -278,12 +278,6 @@ if (!params.skip_fastp) { mode: params.publish_dir_mode, pattern: "*.fail.fastq.gz", enabled: params.save_trimmed_fail - ], - [ - path: { "${params.outdir}/trimming/shortreads" }, - mode: params.publish_dir_mode, - pattern: "*.merged.fastq.gz", - enabled: params.save_merged ] ] } diff --git a/nextflow.config b/nextflow.config index ad407563..a312f4cc 100644 --- a/nextflow.config +++ b/nextflow.config @@ -16,7 +16,6 @@ params { fastp_args = "" save_trimmed = false save_trimmed_fail = false - save_merged = false // Contamination_screening kraken2db = '' diff --git a/nextflow_schema.json b/nextflow_schema.json index a058d287..610ec52d 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -54,10 +54,6 @@ "type": "boolean", "description": "save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz`" }, - "save_merged": { - "type": "boolean", - "description": "save all merged reads to the a file ending in `*.merged.fastq.gz`. This option enables read merging and saves all merged reads to a file ending in `*.merged.fastq.gz`; these reads will be won't be passed to the assembly process." - }, "skip_fastqc": { "type": "boolean", "description": "Skip FastQC" diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 3aeb476b..270aabbe 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -133,7 +133,7 @@ workflow BACASS { ch_shortreads, [], params.save_trimmed_fail, - params.save_merged, + [], params.skip_fastp, params.skip_fastqc ) From 8adff80adc51ec725556eab6e28bd864d343ba49 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 17 Sep 2024 12:04:20 +0200 Subject: [PATCH 32/70] update CHANGELOG in #167 --- CHANGELOG.md | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index deb9df01..2081c652 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -7,8 +7,9 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Changed` +- [#167](https://github.com/nf-core/bacass/pull/167) Remove params.save_merged as merged reads are not used in downstream analysis. - [#159](https://github.com/nf-core/bacass/pull/159) Updated Kmerfinder module and increased memory. -- [#150](https://github.com/nf-core/bacass/pull/150) Replace local unicycler module with nf-core module + bump version +- [#150](https://github.com/nf-core/bacass/pull/150) Replace local unicycler module with nf-core module + bump version. ### `Added` From 37488ee5ef6c342e99b2e1e2233de653804f4338 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 17 Sep 2024 12:56:19 +0200 Subject: [PATCH 33/70] fix wrong metadata in canu input channel --- workflows/bacass.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 270aabbe..28466003 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -231,7 +231,7 @@ workflow BACASS { CANU ( ch_for_assembly.map { meta, reads, lr -> tuple( meta, lr ) }, params.canu_mode, - ch_for_assembly.map { meta, reads, lr -> meta.genome_size } + ch_for_assembly.map { meta, reads, lr -> meta.gsize } ) ch_assembly = ch_assembly.mix( CANU.out.assembly.dump(tag: 'canu') ) ch_versions = ch_versions.mix(CANU.out.versions) From a65648e428a2760ee22d0a40b32fb86b7f0317c9 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 17 Sep 2024 13:38:00 +0200 Subject: [PATCH 34/70] updated changelog in #168 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 2081c652..ab4eeefc 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -17,6 +17,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#168](https://github.com/nf-core/bacass/pull/168) Fix wrong metadata in canu input channel. - [#163](https://github.com/nf-core/bacass/pull/163) Fixed `params.save_merged` to properly save merged files. - [#160](https://github.com/nf-core/bacass/pull/160) Fixed memory issues in KmerFinder, fixed handling of no species detected, and fixed handling of empty fasta files in the prokka/bakkta channel. - [#157](https://github.com/nf-core/bacass/pull/157) Fixed corrupted zenodo URL of Kmerfinder database. From 8bf71a8dd8b738629f6b010bd9dd3a78fe689581 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 17 Sep 2024 15:10:44 +0200 Subject: [PATCH 35/70] fixed input channel to minimap2_align --- workflows/bacass.nf | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 28466003..8c1221e6 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -302,8 +302,8 @@ workflow BACASS { .set { ch_for_polish } MINIMAP2_POLISH ( - ch_for_polish.map { meta, sr, lr, fasta -> tuple(meta, lr) }, - ch_for_polish.map { meta, sr, lr, fasta -> fasta }, + ch_for_polish.map { meta, sr, lr, fasta -> tuple(meta, lr) }, + ch_for_polish.map { meta, sr, lr, fasta -> tuple(meta, fasta) }, true, false, false From 663a7706f5a72942bf9fc18436c4f15f3bbbb3c6 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 18 Sep 2024 16:38:11 +0200 Subject: [PATCH 36/70] refactor longread polishing and update medaka --- modules/local/medaka/main.nf | 6 ++- workflows/bacass.nf | 97 ++++++++++++++++++++---------------- 2 files changed, 59 insertions(+), 44 deletions(-) diff --git a/modules/local/medaka/main.nf b/modules/local/medaka/main.nf index 7cc540be..656f88a0 100644 --- a/modules/local/medaka/main.nf +++ b/modules/local/medaka/main.nf @@ -8,7 +8,7 @@ process MEDAKA { 'biocontainers/medaka:1.4.3--py38h130def0_0' }" input: - tuple val(meta), file(longreads), file(assembly) + tuple val(meta), path(longreads), path(assembly) output: tuple val(meta), path('*_polished_genome.fa') , emit: assembly @@ -33,9 +33,11 @@ process MEDAKA { medaka_consensus $args \ -i ${ reads_bgzip_out ?: longreads } \ -d ${ assembly_bgzip_out ?: assembly } \ - -o "${prefix}_polished_genome.fa" \ + -o "${prefix}_out" \ -t $task.cpus + mv ${prefix}_out/* . + mv consensus.fasta ${prefix}_polished_genome.fa cat <<-END_VERSIONS > versions.yml "${task.process}": medaka: \$( medaka --version 2>&1 | sed 's/medaka //g' ) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 8c1221e6..e339689c 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -294,51 +294,64 @@ workflow BACASS { } // - // MODULE: Nanopolish, polishes assembly using FAST5 files - should take either miniasm, canu, or unicycler consensus sequence + // SUBWORKFLOW: Long reads polishing. Uses medaka or Nanopolish (this last requires Fast5 files available in input samplesheet). // - if ( !params.skip_polish && params.assembly_type == 'long' && params.polish_method != 'medaka' ) { + if ( (params.assembly_type != 'short' && !params.skip_polish) || ( params.assembly_type != 'short' && params.polish_method) ){ + // Set channel for polishing long reads ch_for_assembly .join( ch_assembly ) - .set { ch_for_polish } - - MINIMAP2_POLISH ( - ch_for_polish.map { meta, sr, lr, fasta -> tuple(meta, lr) }, - ch_for_polish.map { meta, sr, lr, fasta -> tuple(meta, fasta) }, - true, - false, - false - ) - ch_versions = ch_versions.mix(MINIMAP2_POLISH.out.versions) - - SAMTOOLS_INDEX ( - MINIMAP2_POLISH.out.bam.dump(tag: 'samtools_sort') - ) - ch_versions = ch_versions.mix(SAMTOOLS_INDEX.out.versions) - - ch_for_polish // tuple val(meta), val(reads), file(longreads), file(assembly) - .join( MINIMAP2_POLISH.out.bam ) // tuple val(meta), file(bam) - .join( SAMTOOLS_INDEX.out.bai ) // tuple val(meta), file(bai) - .join( ch_fast5 ) // tuple val(meta), file(fast5) - .set { ch_for_nanopolish } // tuple val(meta), val(reads), file(longreads), file(assembly), file(bam), file(bai), file(fast5) - - // TODO: 'nanopolish index' couldn't be tested. No fast5 provided in test datasets. - NANOPOLISH ( - ch_for_nanopolish.dump(tag: 'into_nanopolish') - ) - ch_versions = ch_versions.mix(NANOPOLISH.out.versions) - } - - // - // MODULE: Medaka, polishes assembly - should take either miniasm, canu, or unicycler consensus sequence - // - if ( !params.skip_polish && params.assembly_type == 'long' && params.polish_method == 'medaka' ) { - ch_for_assembly - .join( ch_assembly ) - .map { meta, sr, lr, assembly -> tuple(meta, lr, assembly) } - .set { ch_for_medaka } - - MEDAKA ( ch_for_medaka.dump(tag: 'into_medaka') ) - ch_versions = ch_versions.mix(MEDAKA.out.versions) + .set { ch_polish_long } // channel: [ val(meta), path(sr), path(lr), path(fasta) ] + if (params.polish_method == 'medaka'){ + // + // MODULE: Medaka, polishes assembly - should take either miniasm, canu, or unicycler consensus sequence + // + ch_polish_long + .map { meta, sr, lr, fasta -> tuple(meta, lr, fasta) } + .set { ch_for_medaka } + MEDAKA ( ch_for_medaka.dump(tag: 'into_medaka') ) + ch_assembly = ch_assembly.mix( MEDAKA.out.assembly ) + ch_versions = ch_versions.mix(MEDAKA.out.versions) + } else if (params.polish_method == 'nanopolish') { + // + // MODULE: Nanopolish, polishes assembly using FAST5 files + // + if (!ch_fast5){ + log.error "ERROR: FAST5 files are required for Nanopolish but none were provided. Please supply FAST5 files or choose another polishing method. Available options are: medaka, nanopolish" + } else { + // + // MODULE: Minimap2 polish + // + MINIMAP2_POLISH ( + ch_polish_long.map { meta, sr, lr, fasta -> tuple(meta, lr) }, + ch_polish_long.map { meta, sr, lr, fasta -> tuple(meta, fasta) }, + true, + false, + false + ) + ch_versions = ch_versions.mix(MINIMAP2_POLISH.out.versions) + // + // MODULE: Samtools index + // + SAMTOOLS_INDEX ( + MINIMAP2_POLISH.out.bam.dump(tag: 'samtools_sort') + ) + ch_versions = ch_versions.mix(SAMTOOLS_INDEX.out.versions) + // + // MODULE: Nanopolish + // + ch_polish_long // tuple val(meta), val(reads), file(longreads), file(assembly) + .join( MINIMAP2_POLISH.out.bam ) // tuple val(meta), file(bam) + .join( SAMTOOLS_INDEX.out.bai ) // tuple val(meta), file(bai) + .join( ch_fast5 ) // tuple val(meta), file(fast5) + .set { ch_for_nanopolish } // tuple val(meta), val(reads), file(longreads), file(assembly), file(bam), file(bai), file(fast5) + // TODO: 'nanopolish index' couldn't be tested. No fast5 provided in test datasets. + NANOPOLISH ( + ch_for_nanopolish.dump(tag: 'into_nanopolish') + ) + ch_assembly = ch_assembly.mix( NANOPOLISH.out.assembly ) + ch_versions = ch_versions.mix( NANOPOLISH.out.versions ) + } + } } // From 92bcfdecee9a2de7be0675d316e21a082d600cbf Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 18 Sep 2024 16:38:47 +0200 Subject: [PATCH 37/70] add condition to run miniasm on long/hybrid mode only --- workflows/bacass.nf | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index e339689c..4b2b0ed5 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -240,7 +240,7 @@ workflow BACASS { // // MODULE: Miniasm, genome assembly, long reads // - if ( params.assembler == 'miniasm' ) { + if ( params.assembly_type != 'short' && params.assembler == 'miniasm' ) { MINIMAP2_ALIGN ( ch_for_assembly.map{ meta,sr,lr -> tuple(meta,lr) }, [[:],[]], @@ -280,6 +280,8 @@ workflow BACASS { ) ch_assembly = ch_assembly.mix( RACON.out.improved_assembly.dump(tag: 'miniasm') ) ch_versions = ch_versions.mix( RACON.out.versions ) + } else if (params.assembly_type == 'short' && params.assembler == 'miniasm') { + exit("Selected assembler ${params.assembler} cannot run on short reads") } // From fc6c0b91bbfbe067bd6317e1b13c2272052e446b Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 20 Sep 2024 16:20:35 +0200 Subject: [PATCH 38/70] Refined polishing step by 1-removing short reads; 2- selecting the polished genome for downstream analysis --- workflows/bacass.nf | 16 +++++++--------- 1 file changed, 7 insertions(+), 9 deletions(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 4b2b0ed5..9f70e78e 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -302,16 +302,14 @@ workflow BACASS { // Set channel for polishing long reads ch_for_assembly .join( ch_assembly ) - .set { ch_polish_long } // channel: [ val(meta), path(sr), path(lr), path(fasta) ] + .map { meta, sr, lr, fasta -> tuple(meta, lr, fasta) } + .set { ch_polish_long } // channel: [ val(meta), path(lr), path(fasta) ] if (params.polish_method == 'medaka'){ // // MODULE: Medaka, polishes assembly - should take either miniasm, canu, or unicycler consensus sequence // - ch_polish_long - .map { meta, sr, lr, fasta -> tuple(meta, lr, fasta) } - .set { ch_for_medaka } - MEDAKA ( ch_for_medaka.dump(tag: 'into_medaka') ) - ch_assembly = ch_assembly.mix( MEDAKA.out.assembly ) + MEDAKA ( ch_polish_long ) + ch_assembly = MEDAKA.out.assembly ch_versions = ch_versions.mix(MEDAKA.out.versions) } else if (params.polish_method == 'nanopolish') { // @@ -324,8 +322,8 @@ workflow BACASS { // MODULE: Minimap2 polish // MINIMAP2_POLISH ( - ch_polish_long.map { meta, sr, lr, fasta -> tuple(meta, lr) }, - ch_polish_long.map { meta, sr, lr, fasta -> tuple(meta, fasta) }, + ch_polish_long.map { meta, lr, fasta -> tuple(meta, lr) }, + ch_polish_long.map { meta, lr, fasta -> tuple(meta, fasta) }, true, false, false @@ -350,7 +348,7 @@ workflow BACASS { NANOPOLISH ( ch_for_nanopolish.dump(tag: 'into_nanopolish') ) - ch_assembly = ch_assembly.mix( NANOPOLISH.out.assembly ) + ch_assembly = NANOPOLISH.out.assembly ch_versions = ch_versions.mix( NANOPOLISH.out.versions ) } } From c5c32d5593a8878ab75cc9e911177b3c56fb337f Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 20 Sep 2024 16:21:33 +0200 Subject: [PATCH 39/70] restricted the polishing step to long reads mode --- workflows/bacass.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 9f70e78e..17c35732 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -298,7 +298,7 @@ workflow BACASS { // // SUBWORKFLOW: Long reads polishing. Uses medaka or Nanopolish (this last requires Fast5 files available in input samplesheet). // - if ( (params.assembly_type != 'short' && !params.skip_polish) || ( params.assembly_type != 'short' && params.polish_method) ){ + if ( (params.assembly_type == 'long' && !params.skip_polish) || ( params.assembly_type != 'short' && params.polish_method) ){ // Set channel for polishing long reads ch_for_assembly .join( ch_assembly ) From 0917bda1c8cd13ec6a16905a57ca55d0b57e2083 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Mon, 23 Sep 2024 09:15:40 +0200 Subject: [PATCH 40/70] update changelog in #169 --- CHANGELOG.md | 2 ++ 1 file changed, 2 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index ab4eeefc..923df4d6 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -7,6 +7,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Changed` +- [#169](https://github.com/nf-core/bacass/pull/169) Refactored long-reads polishing step. - [#167](https://github.com/nf-core/bacass/pull/167) Remove params.save_merged as merged reads are not used in downstream analysis. - [#159](https://github.com/nf-core/bacass/pull/159) Updated Kmerfinder module and increased memory. - [#150](https://github.com/nf-core/bacass/pull/150) Replace local unicycler module with nf-core module + bump version. @@ -17,6 +18,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#169](https://github.com/nf-core/bacass/pull/169) Fixed long reads polishing input channel. - [#168](https://github.com/nf-core/bacass/pull/168) Fix wrong metadata in canu input channel. - [#163](https://github.com/nf-core/bacass/pull/163) Fixed `params.save_merged` to properly save merged files. - [#160](https://github.com/nf-core/bacass/pull/160) Fixed memory issues in KmerFinder, fixed handling of no species detected, and fixed handling of empty fasta files in the prokka/bakkta channel. From db3eb59762dcdd20ce5f71746fdadd3fed2c77b6 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Tue, 8 Oct 2024 12:28:58 +0000 Subject: [PATCH 41/70] Template update for nf-core/tools version 3.0.0 --- .editorconfig | 4 + .github/CONTRIBUTING.md | 10 +- .github/PULL_REQUEST_TEMPLATE.md | 2 +- .github/workflows/awsfulltest.yml | 23 +- .github/workflows/ci.yml | 17 +- .github/workflows/download_pipeline.yml | 53 ++- .github/workflows/linting.yml | 23 +- .github/workflows/linting_comment.yml | 2 +- .github/workflows/release-announcements.yml | 2 +- .../workflows/template_version_comment.yml | 43 ++ .gitpod.yml | 7 +- .nf-core.yml | 21 +- .pre-commit-config.yaml | 2 +- .prettierignore | 1 + CHANGELOG.md | 2 +- CITATIONS.md | 4 +- README.md | 5 +- assets/schema_input.json | 2 +- conf/base.config | 34 +- conf/igenomes_ignored.config | 9 + conf/modules.config | 1 - conf/test.config | 13 +- docs/images/mqc_fastqc_adapter.png | Bin 23458 -> 0 bytes docs/images/mqc_fastqc_counts.png | Bin 33918 -> 0 bytes docs/images/mqc_fastqc_quality.png | Bin 55769 -> 0 bytes docs/output.md | 11 +- docs/usage.md | 12 +- main.nf | 10 +- modules.json | 12 +- modules/nf-core/fastqc/environment.yml | 2 - modules/nf-core/fastqc/main.nf | 5 +- modules/nf-core/fastqc/meta.yml | 57 +-- modules/nf-core/fastqc/tests/main.nf.test | 225 ++++++++--- .../nf-core/fastqc/tests/main.nf.test.snap | 370 ++++++++++++++++-- modules/nf-core/multiqc/environment.yml | 4 +- modules/nf-core/multiqc/main.nf | 14 +- modules/nf-core/multiqc/meta.yml | 78 ++-- modules/nf-core/multiqc/tests/main.nf.test | 8 + .../nf-core/multiqc/tests/main.nf.test.snap | 20 +- modules/nf-core/multiqc/tests/nextflow.config | 5 + nextflow.config | 148 ++++--- nextflow_schema.json | 85 +--- .../utils_nfcore_bacass_pipeline/main.nf | 56 +-- .../nf-core/utils_nextflow_pipeline/main.nf | 24 +- .../tests/nextflow.config | 2 +- .../nf-core/utils_nfcore_pipeline/main.nf | 45 ++- .../nf-core/utils_nfschema_plugin/main.nf | 46 +++ .../nf-core/utils_nfschema_plugin/meta.yml | 35 ++ .../utils_nfschema_plugin/tests/main.nf.test | 117 ++++++ .../tests/nextflow.config | 8 + .../tests/nextflow_schema.json | 8 +- .../nf-core/utils_nfvalidation_plugin/main.nf | 62 --- .../utils_nfvalidation_plugin/meta.yml | 44 --- .../tests/main.nf.test | 200 ---------- .../utils_nfvalidation_plugin/tests/tags.yml | 2 - workflows/bacass.nf | 23 +- 56 files changed, 1210 insertions(+), 808 deletions(-) create mode 100644 .github/workflows/template_version_comment.yml create mode 100644 conf/igenomes_ignored.config delete mode 100755 docs/images/mqc_fastqc_adapter.png delete mode 100755 docs/images/mqc_fastqc_counts.png delete mode 100755 docs/images/mqc_fastqc_quality.png create mode 100644 modules/nf-core/multiqc/tests/nextflow.config create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/main.nf create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/meta.yml create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config rename subworkflows/nf-core/{utils_nfvalidation_plugin => utils_nfschema_plugin}/tests/nextflow_schema.json (95%) delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/main.nf delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml diff --git a/.editorconfig b/.editorconfig index 72dda289..e1058815 100644 --- a/.editorconfig +++ b/.editorconfig @@ -11,6 +11,7 @@ indent_style = space [*.{md,yml,yaml,html,css,scss,js}] indent_size = 2 + # These files are edited and tested upstream in nf-core/modules [/modules/nf-core/**] charset = unset @@ -25,9 +26,12 @@ insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset + + [/assets/email*] indent_size = unset + # ignore python and markdown [*.{py,md}] indent_style = unset diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index 24edde80..091001c9 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -19,7 +19,7 @@ If you'd like to write some code for nf-core/bacass, the standard workflow is as 1. Check that there isn't already an issue about your idea in the [nf-core/bacass issues](https://github.com/nf-core/bacass/issues) to avoid duplicating work. If there isn't one already, please create one so that others know you're working on this 2. [Fork](https://help.github.com/en/github/getting-started-with-github/fork-a-repo) the [nf-core/bacass repository](https://github.com/nf-core/bacass) to your GitHub account 3. Make the necessary changes / additions within your forked repository following [Pipeline conventions](#pipeline-contribution-conventions) -4. Use `nf-core schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). +4. Use `nf-core pipelines schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). 5. Submit a Pull Request against the `dev` branch and wait for the code to be reviewed and merged If you're not used to this workflow with git, you can start with some [docs from GitHub](https://help.github.com/en/github/collaborating-with-issues-and-pull-requests) or even their [excellent `git` resources](https://try.github.io/). @@ -40,7 +40,7 @@ There are typically two types of tests that run: ### Lint tests `nf-core` has a [set of guidelines](https://nf-co.re/developers/guidelines) which all pipelines must adhere to. -To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core lint ` command. +To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core pipelines lint ` command. If any failures or warnings are encountered, please follow the listed URL for more documentation. @@ -75,7 +75,7 @@ If you wish to contribute a new step, please use the following coding standards: 2. Write the process block (see below). 3. Define the output channel if needed (see below). 4. Add any new parameters to `nextflow.config` with a default (see below). -5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core schema build` tool). +5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core pipelines schema build` tool). 6. Add sanity checks and validation for all relevant parameters. 7. Perform local tests to validate that the new code works as expected. 8. If applicable, add a new test command in `.github/workflow/ci.yml`. @@ -86,7 +86,7 @@ If you wish to contribute a new step, please use the following coding standards: Parameters should be initialised / defined with default values in `nextflow.config` under the `params` scope. -Once there, use `nf-core schema build` to add to `nextflow_schema.json`. +Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json`. ### Default processes resource requirements @@ -103,7 +103,7 @@ Please use the following naming schemes, to make it easy to understand what is g ### Nextflow version bumping -If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core bump-version --nextflow . [min-nf-version]` +If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core pipelines bump-version --nextflow . [min-nf-version]` ### Images and figures diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 99d5b0f0..a7d7f397 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -17,7 +17,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/baca - [ ] If you've fixed a bug or added code that should be tested, add tests! - [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/bacass/tree/master/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/bacass _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. -- [ ] Make sure your code lints (`nf-core lint`). +- [ ] Make sure your code lints (`nf-core pipelines lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). - [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index e11165d6..60fbcf48 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -1,18 +1,33 @@ name: nf-core AWS full size tests -# This workflow is triggered on published releases. +# This workflow is triggered on PRs opened against the master branch. # It can be additionally triggered manually with GitHub actions workflow dispatch button. # It runs the -profile 'test_full' on AWS batch on: - release: - types: [published] + pull_request: + branches: + - master workflow_dispatch: + pull_request_review: + types: [submitted] + jobs: run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/bacass' + if: github.repository == 'nf-core/bacass' && github.event.review.state == 'approved' runs-on: ubuntu-latest steps: + - uses: octokit/request-action@v2.x + id: check_approvals + with: + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.review.number }}/reviews + env: + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + - id: test_variables + run: | + JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' + CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') + test $CURRENT_APPROVALS_COUNT -ge 2 || exit 1 # At least 2 approvals are required - name: Launch workflow via Seqera Platform uses: seqeralabs/action-tower-launch@v2 # TODO nf-core: You can customise AWS full pipeline tests as required diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index f44d81d7..a1eda2e0 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -7,6 +7,7 @@ on: pull_request: release: types: [published] + workflow_dispatch: env: NXF_ANSI_LOG: false @@ -24,7 +25,7 @@ jobs: strategy: matrix: NXF_VER: - - "23.04.0" + - "24.04.2" - "latest-everything" steps: - name: Check out pipeline code @@ -38,9 +39,21 @@ jobs: - name: Disk space cleanup uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - name: Run pipeline with test data + - name: Run pipeline with test data (docker) # TODO nf-core: You can customise CI pipeline run tests as required # For example: adding multiple test runs with different parameters # Remember that you can parallelise this by using strategy.matrix run: | nextflow run ${GITHUB_WORKSPACE} -profile test,docker --outdir ./results + + - name: Run pipeline with test data (singularity) + # TODO nf-core: You can customise CI pipeline run tests as required + run: | + nextflow run ${GITHUB_WORKSPACE} -profile test,singularity --outdir ./results + if: "${{ github.base_ref == 'master' }}" + + - name: Run pipeline with test data (conda) + # TODO nf-core: You can customise CI pipeline run tests as required + run: | + nextflow run ${GITHUB_WORKSPACE} -profile test,conda --outdir ./results + if: "${{ github.base_ref == 'master' }}" diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 2d20d644..713dc3e7 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -1,4 +1,4 @@ -name: Test successful pipeline download with 'nf-core download' +name: Test successful pipeline download with 'nf-core pipelines download' # Run the workflow when: # - dispatched manually @@ -8,7 +8,7 @@ on: workflow_dispatch: inputs: testbranch: - description: "The specific branch you wish to utilize for the test execution of nf-core download." + description: "The specific branch you wish to utilize for the test execution of nf-core pipelines download." required: true default: "dev" pull_request: @@ -39,9 +39,11 @@ jobs: with: python-version: "3.12" architecture: "x64" - - uses: eWaterCycle/setup-singularity@931d4e31109e875b13309ae1d07c70ca8fbc8537 # v7 + + - name: Setup Apptainer + uses: eWaterCycle/setup-apptainer@4bb22c52d4f63406c49e94c804632975787312b3 # v2.0.0 with: - singularity-version: 3.8.3 + apptainer-version: 1.3.4 - name: Install dependencies run: | @@ -54,33 +56,64 @@ jobs: echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> ${GITHUB_ENV} echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> ${GITHUB_ENV} + - name: Make a cache directory for the container images + run: | + mkdir -p ./singularity_container_images + - name: Download the pipeline env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images run: | - nf-core download ${{ env.REPO_LOWERCASE }} \ + nf-core pipelines download ${{ env.REPO_LOWERCASE }} \ --revision ${{ env.REPO_BRANCH }} \ --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ --compress "none" \ --container-system 'singularity' \ - --container-library "quay.io" -l "docker.io" -l "ghcr.io" \ + --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io" \ --container-cache-utilisation 'amend' \ - --download-configuration + --download-configuration 'yes' - name: Inspect download run: tree ./${{ env.REPOTITLE_LOWERCASE }} + - name: Count the downloaded number of container images + id: count_initial + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Initial container image count: $image_count" + echo "IMAGE_COUNT_INITIAL=$image_count" >> ${GITHUB_ENV} + - name: Run the downloaded pipeline (stub) id: stub_run_pipeline continue-on-error: true env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results - name: Run the downloaded pipeline (stub run not supported) id: run_pipeline if: ${{ job.steps.stub_run_pipeline.status == failure() }} env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -profile test,singularity --outdir ./results + + - name: Count the downloaded number of container images + id: count_afterwards + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Post-pipeline run container image count: $image_count" + echo "IMAGE_COUNT_AFTER=$image_count" >> ${GITHUB_ENV} + + - name: Compare container image counts + run: | + if [ "${{ env.IMAGE_COUNT_INITIAL }}" -ne "${{ env.IMAGE_COUNT_AFTER }}" ]; then + initial_count=${{ env.IMAGE_COUNT_INITIAL }} + final_count=${{ env.IMAGE_COUNT_AFTER }} + difference=$((final_count - initial_count)) + echo "$difference additional container images were \n downloaded at runtime . The pipeline has no support for offline runs!" + tree ./singularity_container_images + exit 1 + else + echo "The pipeline can be downloaded successfully!" + fi diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 1fcafe88..b882838a 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -1,6 +1,6 @@ name: nf-core linting # This workflow is triggered on pushes and PRs to the repository. -# It runs the `nf-core lint` and markdown lint tests to ensure +# It runs the `nf-core pipelines lint` and markdown lint tests to ensure # that the code meets the nf-core guidelines. on: push: @@ -41,17 +41,32 @@ jobs: python-version: "3.12" architecture: "x64" + - name: read .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.0.0 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yaml + - name: Install dependencies run: | python -m pip install --upgrade pip - pip install nf-core + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Run nf-core pipelines lint + if: ${{ github.base_ref != 'master' }} + env: + GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} + run: nf-core -l lint_log.txt pipelines lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - - name: Run nf-core lint + - name: Run nf-core pipelines lint --release + if: ${{ github.base_ref == 'master' }} env: GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} - run: nf-core -l lint_log.txt lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md + run: nf-core -l lint_log.txt pipelines lint --release --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - name: Save PR number if: ${{ always() }} diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 40acc23f..42e519bf 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -11,7 +11,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@09f2f74827fd3a8607589e5ad7f9398816f540fe # v3 + uses: dawidd6/action-download-artifact@bf251b5aa9c2f7eeb574a96ee720e24f801b7c11 # v6 with: workflow: linting.yml workflow_conclusion: completed diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml index 03ecfcf7..c6ba35df 100644 --- a/.github/workflows/release-announcements.yml +++ b/.github/workflows/release-announcements.yml @@ -12,7 +12,7 @@ jobs: - name: get topics and convert to hashtags id: get_topics run: | - echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" >> $GITHUB_OUTPUT + echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" | sed 's/-//g' >> $GITHUB_OUTPUT - uses: rzr/fediverse-action@master with: diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml new file mode 100644 index 00000000..9dea41f0 --- /dev/null +++ b/.github/workflows/template_version_comment.yml @@ -0,0 +1,43 @@ +name: nf-core template version comment +# This workflow is triggered on PRs to check if the pipeline template version matches the latest nf-core version. +# It posts a comment to the PR, even if it comes from a fork. + +on: pull_request_target + +jobs: + template_version: + runs-on: ubuntu-latest + steps: + - name: Check out pipeline code + uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + + - name: Read template version from .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.0.0 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yml + + - name: Install nf-core + run: | + python -m pip install --upgrade pip + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Check nf-core outdated + id: nf_core_outdated + run: pip list --outdated | grep nf-core + + - name: Post nf-core template version comment + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 + if: | + ${{ steps.nf_core_outdated.outputs.stdout }} =~ 'nf-core' + with: + repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} + allow-repeats: false + message: | + ## :warning: Newer version of the nf-core template is available. + + Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + Please update your pipeline to the latest version. + + For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + # diff --git a/.gitpod.yml b/.gitpod.yml index 105a1821..46118637 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -4,17 +4,14 @@ tasks: command: | pre-commit install --install-hooks nextflow self-update - - name: unset JAVA_TOOL_OPTIONS - command: | - unset JAVA_TOOL_OPTIONS vscode: extensions: # based on nf-core.nf-core-extensionpack - - esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code + #- esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code - EditorConfig.EditorConfig # override user/workspace settings with settings found in .editorconfig files - Gruntfuggly.todo-tree # Display TODO and FIXME in a tree view in the activity bar - mechatroner.rainbow-csv # Highlight columns in csv files in different colors - # - nextflow.nextflow # Nextflow syntax highlighting + - nextflow.nextflow # Nextflow syntax highlighting - oderwat.indent-rainbow # Highlight indentation level - streetsidesoftware.code-spell-checker # Spelling checker for source code - charliermarsh.ruff # Code linter Ruff diff --git a/.nf-core.yml b/.nf-core.yml index e0b85a77..41499001 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -1,2 +1,21 @@ +bump_version: null +lint: + files_exist: + - conf/igenomes.config + nextflow_config: + - config_defaults: + - params.dfast_config +nf_core_version: 3.0.0 +org_path: null repository_type: pipeline -nf_core_version: "2.14.1" +template: + author: Andreas Wilm, Alexander Peltzer + description: Simple bacterial assembly and annotation + force: false + is_nfcore: true + name: bacass + org: nf-core + outdir: . + skip_features: null + version: 2.4.0dev +update: null diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml index 4dc0f1dc..9e9f0e1c 100644 --- a/.pre-commit-config.yaml +++ b/.pre-commit-config.yaml @@ -7,7 +7,7 @@ repos: - prettier@3.2.5 - repo: https://github.com/editorconfig-checker/editorconfig-checker.python - rev: "2.7.3" + rev: "3.0.3" hooks: - id: editorconfig-checker alias: ec diff --git a/.prettierignore b/.prettierignore index 437d763d..610e5069 100644 --- a/.prettierignore +++ b/.prettierignore @@ -1,3 +1,4 @@ + email_template.html adaptivecard.json slackreport.json diff --git a/CHANGELOG.md b/CHANGELOG.md index ef804631..86bfaf24 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v2.3.0dev - [date] +## v2.4.0dev - [date] Initial release of nf-core/bacass, created with the [nf-core](https://nf-co.re/) template. diff --git a/CITATIONS.md b/CITATIONS.md index 79501bc6..69cdc739 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -12,11 +12,11 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) - > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. +> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) - > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. +> Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. ## Software packaging/containerisation tools diff --git a/README.md b/README.md index b04b8d13..8d92a187 100644 --- a/README.md +++ b/README.md @@ -9,7 +9,7 @@ [![GitHub Actions Linting Status](https://github.com/nf-core/bacass/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/bacass/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/bacass/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) [![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com) -[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/) +[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/) [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) @@ -67,8 +67,7 @@ nextflow run nf-core/bacass \ ``` > [!WARNING] -> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; -> see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). +> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files). For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/bacass/usage) and the [parameter documentation](https://nf-co.re/bacass/parameters). diff --git a/assets/schema_input.json b/assets/schema_input.json index 80a92312..f221d751 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -1,5 +1,5 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/bacass/master/assets/schema_input.json", "title": "nf-core/bacass pipeline - params.input schema", "description": "Schema for the file provided with params.input", diff --git a/conf/base.config b/conf/base.config index ae9bd1fe..71dc2a47 100644 --- a/conf/base.config +++ b/conf/base.config @@ -11,9 +11,9 @@ process { // TODO nf-core: Check the defaults for all processes - cpus = { check_max( 1 * task.attempt, 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 * task.attempt } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } errorStrategy = { task.exitStatus in ((130..145) + 104) ? 'retry' : 'finish' } maxRetries = 1 @@ -27,30 +27,30 @@ process { // TODO nf-core: Customise requirements for specific processes. // See https://www.nextflow.io/docs/latest/config.html#config-process-selectors withLabel:process_single { - cpus = { check_max( 1 , 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_low { - cpus = { check_max( 2 * task.attempt, 'cpus' ) } - memory = { check_max( 12.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 2 * task.attempt } + memory = { 12.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_medium { - cpus = { check_max( 6 * task.attempt, 'cpus' ) } - memory = { check_max( 36.GB * task.attempt, 'memory' ) } - time = { check_max( 8.h * task.attempt, 'time' ) } + cpus = { 6 * task.attempt } + memory = { 36.GB * task.attempt } + time = { 8.h * task.attempt } } withLabel:process_high { - cpus = { check_max( 12 * task.attempt, 'cpus' ) } - memory = { check_max( 72.GB * task.attempt, 'memory' ) } - time = { check_max( 16.h * task.attempt, 'time' ) } + cpus = { 12 * task.attempt } + memory = { 72.GB * task.attempt } + time = { 16.h * task.attempt } } withLabel:process_long { - time = { check_max( 20.h * task.attempt, 'time' ) } + time = { 20.h * task.attempt } } withLabel:process_high_memory { - memory = { check_max( 200.GB * task.attempt, 'memory' ) } + memory = { 200.GB * task.attempt } } withLabel:error_ignore { errorStrategy = 'ignore' diff --git a/conf/igenomes_ignored.config b/conf/igenomes_ignored.config new file mode 100644 index 00000000..b4034d82 --- /dev/null +++ b/conf/igenomes_ignored.config @@ -0,0 +1,9 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for iGenomes paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Empty genomes dictionary to use when igenomes is ignored. +---------------------------------------------------------------------------------------- +*/ + +params.genomes = [:] diff --git a/conf/modules.config b/conf/modules.config index d203d2b6..d266a387 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -21,7 +21,6 @@ process { withName: FASTQC { ext.args = '--quiet' } - withName: 'MULTIQC' { ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' } publishDir = [ diff --git a/conf/test.config b/conf/test.config index 686fa026..3d189cd1 100644 --- a/conf/test.config +++ b/conf/test.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data // TODO nf-core: Specify the paths to your test data on nf-core/test-datasets // TODO nf-core: Give any required params for the test so that command line flags are not needed diff --git a/docs/images/mqc_fastqc_adapter.png b/docs/images/mqc_fastqc_adapter.png deleted file mode 100755 index 361d0e47acfb424dea1f326590d1eb2f6dfa26b5..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 23458 zcmeFZ2UJtryD!S#x<#o93es(Ww4k)maRbte0-+a?-g^xY-3myTE`8G_KvA54)F1tn})nJ5u%TA4Y;^!^{48eL_}p#q-Umo0M|F1 z74+PQh^X8N|9_jcWbq~ zzn+tZC9B75nKdz=gQ8wo9GJ$P{D~3knlI_`-PRhCw34f1oYDLr^;oEbgxa#A^J%*2 z>FfDE*(~JzKFs$t_oeLz))qDU?s}%Q?7b~3Y;lUi^Oy-2@3g?joA4Wkgb6-2=ih*jub)~7yZ`T=L=Z`B`{1jhkB-iSjea94&Eo9A zxN59pv1p_}RO1>EC^q}Z2)ZI;b7JV_x4lMr=Bker2+EK;8~!;JO7re*@ZkDmoV878S*N^yX(F@U1yqt?Is3nnV>7}#(5pk`V3C) zWhB8;CwWIwsVIjH+`<9=YA(j&3DgQdFOOGU~*`36wNC&QDv8> zr?h2PQgnHkp&t^S)q^K!68h~`$PjZW&-Wns;Zlw$M2sc z1xR!u{m|Kih*|Hht#M@eOMM#8O*={^6b9k5B5^eBsrnhVHD7XZ5BWO&F?q(>Y=QFl z`f>yQ9NCoxZCH-1F{#mz_j{QeyY~4h*VeyYZ#S@Z(Pnb7G=ud!RW)5svqM*&GI_za zzn;8LkOTT?``1Ygt6w!2;5arK*o5k15cdIJnMg)IQhF_zVK%!ma$z&jL zZt>Q{!PqKl^`Qw?nJUOEm@@qX(y(TwSJ~dqW&M@7-N4Wk_wC4izx(xJMrmNjsl$XR zCyK&INt}7@FzNAbbg-nW)sJ>3->I1+2~YdlPsaS}^X-H0GR_CEsw`PGjpq`uX}8VP zJ)HC34>D(z{KR9;E&z=@?@q_|I{NPOj~g>w!$gR?Tlu~F+L$Mk%}xQEm+{&T(5zkH zacVy0k3w!T9r*p2sgX@V;^+PfUYUrEde07XSV=KSDbkIZU!j!Rk3MQV=h-!y@kWVB zdYkmu^fiU~pp#ixe4hBEMx7^LdHa z_L*14aVIHtrsR)SO?=&kQS&JR#^AVvln=P=bUXEIy$QB&!s34znCV@y(C%j9V=}SU zoYLHn+-Lalm0$-=QQ}a(+2dR*{DPF+)J4y!ukiA_T%dF zVKEk;c?LWheG#A5{A20}CKjMw5G%2}cT5@Oce=wqdobHC70=kY7}dxt3diH9(Zcwr zCabx8yObHQ@#e_wjl%wp8s_!Wvxe5f-Duin@obgt>qOcqN$$@{X^C_rEDh3fmM;|X z$zu4;D`{YRbaJ?o!KkazII&|th9v5MG2Mao$ytOHtW+wo;XJJdtLuGjg;d020qT++ zpD}e&o?SeKSqR`}4`OdkWNC7K)Wltn zbwBrWGM;bBGm8uP_RiqfwvDD1f+uRX>b=nTH9Y%vpg{ka0e*E>%<+3!G3#s*-1D>q zHg~1@BT52a*L>mVcP>6y*0iX8@!3tDFJLE+sRlnU(cl``hF`0Q>e4i6P8|wKmqIqI zoY+a0V*Bib0`F9nG#sR(8$^!IWLR)cE8@7XZTN%L-ucJ{9yijy)w5Pom%XG7V<^PX z$Z$U82w0qgcGmld-O6*e)?pm$g@!6`Pps5SPKccjDf(|vX9zcLs7t!7cyyckZI#R* z#lj(HqfVeqyZ+Va{)>65sAb3IQ%a{9W^_F!5!;w=XD}ZUHFH$8=Xjw+VE)s$q(nt> zE2^aDYki5`e73RQ=DxaBNZ6CK?XKCv@V}=y(g?YHnFaHfXnl}Lo;36@?471W;&#Se z>pE*@M{Y?CevLG8il9#HXG#W3>;o$1``EYBY5i<;JlBqj2M8Y2!+6bPj1(S_bOksY z<34UQE;=Z>KiL``pYd}5fpOOT)GJQnXfNiAc5wgJ>F|$Eqw&D*Vmz+#mM0oFD^`-^ zB~SXe{T+5hd$gnKd7Afo9cy&Lii@syPDFDK)^V{iWEAEO@?xzx1bd`ta z;$(vG+=i3~9|D=GX%f~<>eOVjy~-yRAhLf2dR8V<@M_`C^ev(yOTg{uf=L3uyDb-w z&)l7KXS_HTo87BxI}fXF{ge&5p&IHk9M1}eNAwqw)`eZSOPFhqjS70{hyE@C{oSN$ zam*`-UH3RF-RWEP`^Su1q#n_J{AncekkV4m7YITf%QHBo60h@pk4N4O}hhf%rxuIZGiQpprVMal%h7?8+cY#L>pYnx6v!EnuIgInW` z)w!NuTp;fz9md^}*x@K9+`^2LO*bZp1^?BG#iS@(4i%AB6YP023T8Eb?M5K7ElSpe z9-wA22Mm}VwDkmECLd*}a=7bCf(}@SHs6UBe)Xvk(+hQ^^unj5JBeo$=><{4PBI%P z4_9XQ=XnE``;1Daa6f`~rGwNj9{YXY)eIw3G90Ip+QEWg0%?g=i$UHuQ?Qc0OR0!w zv?BvlQa!QMyI*IP!0>goBt$xo2^hlD&wRp?$=}}#?q~Yw z{**_|5&yL*Epz|4V#SJjg-lNaIx_{sCL3R=_VH&_;oOn5J2P=h!0enu-i%FAZ- zw`Hm*u6N*}&A7pAqr>-?%0(lveb{r8>hpDmex?Yo*8!-%1?YV0R~VEPBFp>)ba=mv+2(#>WEy0yxHZX=Cr2 zKmew%=^>HsD3BtRR*#H!@!TTGcI&fHrVh)P&|X;>)OHML+uWDn(dlsDjXa;5uBM$r zdt!r~ig?5iGbx!GpH+kdG8k0%;~)Q#0L6wFROJ}^Z%DvO3x#yNk13^&ccd&l)BP9h zD5cU-qZg-rV3Sg&?)`x}cI3`zw#zq{-eN4pNf(+?QuOG4oZ7zMGSVqOUe>`u=GfKM z{xPCciJFw9%Pk+uDSoormR&c=fS#hGOk=RGUtizBOoY^8P(>!Si|I9i=1ZCQbcc)5 zgE6UED;+b$4u&#dhZjdXwO3tpG0QaQwXrLOx5YP#TOaS@FP!h|G!z!Pbv?hTp0eQL zoUsiv4d@*Ck#ID9-ua|zPbQepcC4a>>9-bJApd()Wg%}hj#%A4pO-q{jIJ$f-SL7- zo&=keG_jhq$Ty4e|J^l6j6TQ=W)|~&Ei6gRn<{*^cFG*tS19#kHpMD7Y;wb~!3_%X zS_-3NQoGiWCX!M-Id;Nsg7oSi4VJ=Hi{bYNfjnmTq?IyK@@&_uacfb&8h@DIe70-Q zZ^KaT(4UX*vf7@A7CY;P!IVGIuXPRIe^&71Z1EyHO5&^=jUUKHF+h&m!4!dOA+!Ed zfA#uQ&p6vD7|O8(?5`bf8^gK)6p`>+$c*yG?Sw29;OD+tp}kDD9augDAEXWbSVoie zpHF1Wj8lWfIZ}mx%(2XREqF9!{fNd&iurAaoQDMCSNo!vRHE8wH%QLLZf9u;ADqnxOaAD#VE%Yg z?Gb?EmGbY}a0|vSZPlF3z6;Kf669Bf%h zlSGiY-}E4LFurm_CJN)(*l?=uX);o&R&qLuzENz?9I%S&YQ2>rVhx#c!hbvWLL!CI zA8mXM$zjnnJ#Me@-99}hjxCE!w8|9w{SBlj%Miq#dvS5GHP!DxO$sDx^4PF^#`;A! zb=bZ1pyj{R#9h$r7svB$QlJqeF1cp*ubT12UZ!deKFG%1N<@S2x&2UtqsVz zn=gF&$D4i3x7&vdoa#^cS?bQuP69OpspVPxm*%@DSWf!NG`o`y^R~o1Hvta;#!r%i zvEB~Jsi~sJ7Y35P!bf?OQin->fAk+TpU$Ow1st|l9|i2rrOneBP3&aDyoUj3K{a7! zOYpnJyYD#nr4GNJ;@$ce2dSN=eS7f-VptzM(|Ek^ze)mPVrpAEgrFs3mL>f(ZwriH zCZ65HdO0|W@2<+v9t?J=-4U9>bvM@@Ew4uVZy@c^Ovw9`k|$!+CTAn(u#4kC7TVTB zXuy#d+GC@RIMaPyp|Y2jS%RJkktCracCaLqfs^i^XFqK#3z+d}n02*VDF&My)vp)lNzWx<< zGB7hEAH?7_joYR?>+&+JIas*%Oiux%kr*X*B=8N8Ulowx0MkRK?pR)K1F_m8>dSe54 z)48k>#|F!OV#yOs7xQNQ@1iun5pl;py{tx+o044?r{W2O{f}3r{#QS#4bf(|f9R3y#6*0YY) z5Ey{M`dj)yHl)B{sdmvti^b0IE5xFx%jJM&5w69;`PGy0vGk2ztSW|5H3~zhXO?mn z+4mo>;Y7=4&gC}HifyMO`#70u3H6;0|| z!l=0lP|zVF`bfxm{%i98943^7y4Iz};Z9F$oY3iUI*FIsYa=o=nS^d`;3?*wDxi&| z=?oqs6uDcd1e_e5z7M5q(+I^PilSRE(T6%z<=U8%sq63V!wELY9Rj%#Y@2Y+TEJ8(f_Kh0ih?l6E6~wDl3~?-5%7>d{ zKs0XHUeORoi5+U#M{kE!Ae%|)^dabh1DsJI9N~LVXp*8$XlOfc6J+Cc?}SM zsc3N~L7hzcpXn2>b(_YN=J*C0N}$f_NINTiV!~L}nA{wn^XfBogd5hu!G?*THg^mF zFJm@9m{X~X3t5{7 z#lWIO++R8;BTByGl7U;fz|JBB^*4R|bLvm18x;DF*U`=kyxbH2nD*RIH5AWfJ4^5o z&Nr;*|NreNKo$fUI5}~n#Xcbjr0T-7MV;wZXA(QPt^`x;=ZK)5^`AFgQM?7ry_(Tm z0|EhWs&cYJW?|uvc3af(tfuyDf$28~R=HOa#}3Edru##Wwm0a$Vnk=_8+eQ; zfyq+GVt0Twr^QS*HtI+&&>_<%-Gq-!{iQr-3LYn-6bqW0VW)>%iat!2IP)Jd+LgnS zgI+jJ-I9HMJ8Z*$2FjwK1T0RpF%U`&x)S{3HqRJ z5^;r?VoA(k7*aP@tzB`O5Y26jv#x54xNH;E`KzzLxC)FEnQ<}IR#w*>9sq|zFzZq< zdM1%ynXvcLfZ{Xm=l(Op?=XGV8`BwRiQ%@@A-GnjD+y3K zN2Pm011b!s`3368%P&MapW-PDulXKfpeyRXNjN`lKKgC%CplwE#GrRw#0FE#Q4>R+ z23B4CmO%uy8Y@;F$hCHU6+oJ}_cKgm|4Amr{$`38ue-?+GX1T!hd$w@x=z{w30Z*W za@$MLl^=f#*oR+8(&a&`E@Bj{{1O;DPjj$g9U7~{m*?^Tj}Rrc^wc=(SycXVT?bW{ zUus*6{74fo{nOh@zQyv0g{)t}Qekl*>KXQYCI9m2jqge|&Ntj{V?gLs*_GkeODYhf zW39Q1L1~vk+#E^S!nCyO&z9Wh}2=K}`9#{=`j&)^}8=U|lz}DqgAteVsos){s zDhK`>&pK%cVuhO7tPu7@Y4|yXAdHs!(uKDuLL@i$Okc6Gs;2456Br??ZNZiONAe!~ zvY5w1(C)E9fRmpWgWU2Su0u6~9{@wIm<-lha;uuEN>&C^FJ#^|oopkg``l#i0&{OX z%rI6Q>l^9J++K19D;HrFU#V9o0M`MBTT#-(q&A{|n-`T~CgAFET=$E_&pIQTPE;J#&nrwf2N^I*d zH)ev~7d=Sy8<@syK<`PFvNtyfa#8^JceG^ua^o%!fl6R&j--jGkz8wS`EgfEZouOD zr97H059Dj(#$*$-!UQLvb92wS40!wJc!4K~lq-K2h2rXunCs?SjQERnvv9Fs?tF;y zWUTcQ&PtDMbsUY6_&np`UGMS0ZZIhnDh~p{`Bryj7XS~*R}%z6 zUO^hJn$_-CW(;$)hHu0ej1BNqv^o%*D2gR6zUvCZyw)ddNB6JE$;okhf7PEEz|dRN z$sP&o`MU(L_I8mDW33;)3!U*;HRm$zVV%%zaDn^*Qj~RdWdFNb;^fRhnF&{oeY-tv zq$p~pZw)Ls$EWKsEZubtx_9bpdCfsjdy*<8_Io8VtCIC+8kk@Qxdti>xnu}nRYJ-y zp8$3YP7u;u+YlPQ2`o_>S?mpXvd0-x!Z3=}>ceWDg*e)+#wQLE)Uwhneo z;*y`VfoY<#lwT^k4BP(ytfI;M`FoYsedi}L{1V|Ho}ciBs=`@vtgnieHdpWz%Vyy$ zlnn?k0KJWOnlJD9>6y64*X=G{lyl&%pV8Uo&>tXw%1za!6*YYVB$jR$Y0XhB#1mVx zvjd8N4X~{Dd&28RVEkCw9TLN9*Ng!?9F88l2Bl)w%7!97mtx5(Qx%1u6h+$OGa4#qGGGI{Pj4d)5yg8F4O2sfu61u0uM}?$_nH8=0St?`ogZ@1LAr@*uC4Z9(|dIQ z?OH<_%?PD56K*Kty@PQT;W#)tazY~|I7-aq)tQ($$#Q?{gEbJwJK3mnk)|l>XgmJQ z_POHzee+4NEWu0i0zUFmLTF(zvD3B%sp1_F7 z<|O7{-oZ2>t9k~zX0MDQ(4&(YZ#~baV{$ah?o_K1p$Ad`PAvgtuhW(xO{@bMjNb>Y z-k>lsDx?xX;x5*9RSpJe~BwLtb79%{p~+JTs5HZ&#({u>j3kAOLx*Y zW{7^+`OD%vhcxVW39F$jZ;I@H`3X?>Wwt@269f1o{V4-t-|dX4x7L3j zUHltoa@jqToWvn&=0CF%6%D0h50m^)qaXkRMC&Owv8iG~$}1PBgld3nBE#Rg(5)8n zga7!2@yjoBBoF_e3M$ongy7N1L_hT@!LUaCXX6QLZFKcq1r;;Z$sca}zfwaCji7PcbfW7H9p`7Eh$-j*7-=%{5f&}TidFWiMr=NYvc}Q@gh_z)<;^d&F zd@za3ugvK(BbprUX|)`Rk0&+6)#sm5S8a7;dzrqn*f)iXpvW$BVu6u)bR+ywtGne@B61Om=Q)yvb`45S}|LKt&5@)wSOfk;LhZ^UofjlQz0h zm)>a9f&40n$;-ndr=xntY3nOFGmA5POfiIsfgTzT*Cl zU{P;It;qo}n}IeEA1&?GRONCJp3=_!ce2$kKRZonNV+tS_uFPWzeS zhqSPws(Jp?TsgNT7yGtphSz=h2-}y#HTWNE#@LHFs^pseT#RfN*P8yLUm`jG1N5s* zfU25qv2akmjD=Q`s4SJxi@i`xIOCdT5B%W6wj1Fz8)Kuv*iB`}b^(em~z zz4~VcUB9M5@W}s3-SOWXu+*?)Al7p)Bw?jh8_#s)>lYp{{b%_vCY00=iC@I3$FcpY zYuOjg948l-C~}cDxL!%j&X1(H6ZC7U5?oVLQ<)zh*qg)k6HdNPB;PQcbVRXucl7>@ zE`Ga=^8RPrIRE!3E#e-v8MTy%%a1yk_k{s|V-=5ML7(Mg#S@LA3;rEyjF&X1w*^R&VJ>2%B@{=W9BD)oa@0!_Gl{G8Oe+Vki1QQWd~<<~Et zEV_YlJ=t8VXv>#L|FKXIJ)GZ1(d6xUoSPZVFOzMhM$6tgyhWq=@}=HzWm&b4o8R}L zQd7<0PV(LqaHYNNcXtTN4rc2ov$)VeRm&}XS-vamGB^G4tspa#HrPa5#22^pb?s&W zS%!p!fba6R+WLMjkeUo!qpKob}#cMpU4(`C+U6R8i>qlJ&Hbh52enW<`FmyjlhwlfIlxyu$Pg z3uS-Qau7K~%A$hBFocIe2<$LBIbEI!uddh9(JX=++R9aM|DO2#5*qKh#Zq^~O40f6 z0#s@~v{DPy=4^A}ieKe(Idu22Ex4~>p=#u?w_Lx>bHE@Z4Dh%iKrDJj2IJ+qNDIxj&WPRXRSaNz$JyFkpFK#gLAB6G;4KKql{+5w z{2yWKln-fjDCc()q_W&mmIx?JvpXPb{)hR&ok40*!M7lC!&?b|=efwVb@r0;FeD2( z*x!h~5OA8DEVr>6PS6o_oYt+7HY+d${lh@ruB?hP=`vq;@uLNGIb%@~*X54+`NY0- z35nZLFQArwtL~;t?sb(T6k;wi@v0FFLV}%b1@;p|R%u%8ROV= zRWO3*fG33>>}We#nQ5Vk3gY2ODY5fL+-E@ zvWG%=(;1n3UEEjqSDn9V_C*FMSXjR{uYKa`>$>D#@FacqRX4qmy{)y4&Gf)@V_BVr zvNEa@r<%e5HW?jhEb!SY6v|~N%22Y0992I>~ud8In`Lf`QStH3E)x@G=`2&AraN&V){PF%a=v)Pu{I zuQ7a;TZAlAgDiVUO+`B+z-8%M0kCiylcazP7I(w|^h*D4Sn6R#-jd7ZMN@iJo=6v2GyL zo;~Df{e7CCta*U4B1pD0lfi=EwI3CTf2}#(`mwSD-u-%XLU(&V?BTG?P-Fx}R5*E5 zcvSdpxqh`s3e`yRJ6%Efp|NYd2}SjJ)h@$9391YRLSU!qq4E=W9yx#}_KqRcG)(~r z!+&i&OckDJQ2El}fI8mdeCHPcJ2=byp-dT&ZFDzLuqc{lvh)^vKB2 zL}g}~j~QUN0Fo{!0BTTKwrDjx#j6KVb>MsCz=!G& z0?uz!q)+3>Q|KAM0zy>+^zjMt4}XE)t2HIfc*Tmi?$;KdI7B#Aw9_O-Zg>98L}4}% zna0Es9syWr5+f5RGVqawtNUt}*r|Zy#6ay+mEGaSGMmMOW%88u6mXzDD_wlGT6!zy zpLOrO442P{0J&IYJjqwrVrEF87ZDTT<9iz5xv)C#pUTTj+d73+z7GI`Ehx*q&zxS(F>^b?4*udLeSbU~XBKKi_PI+| z`R!s3tpv7gX^R3~Cce0vX(P9@UCS)XwG6mNX_eM`6X(`UW>OMp*nTlrcUU?`gCzDr zKR0P?yj9z#ME0=e!>GupM|%&t{Qcx)sN)wVzW*5E>yxt5g6NEc!GR+F(!Nysd6n&^ zN?K|Q@t>y$%H^ z1}}eMB%-GY`CK5%Pj}AkUNRem1zBUE6y}0KA;6;dZu&VyB`KCwPfdQ5Xri>Osl*$@qxi zNUlL!r3OOxC4C`xXPqL4Ec)b`ajpfaw12E4xMZ6=Yyb-WN0LL2RUzLj zAKS$6X%>ekm|3yQ$#-`3N8ah|B+0f4bxDc4nfJcHZ{dlBeXYRL5bY2afSAF|vcc%G!HPxGS8==1)_U|T zNvWWGt}f~OGmCtqW8>q3f@5Go0Rce)p>g@dgop$3UUF3))$Wn6gRX7M3GQ}?tC)i6 z5#2fg?U#)GsvTF-;w zY-Nw9hPGMC9F9(W5F-PUEmiuS(F06nlcE{I)}b=%A7_~A6cEH$BClS~DB|X6Z*IT2 zIpOX|#S?qiLR2Osk#^=DtNG&ym+&FR*Kv8P<@ep!ZLZtJSjcEO2t@V!3dE-*!yhNO z<`xWq;JT2z{)iLD9MQ;&^p<*B%Gv z9;zH_>TGtlGO@9MT_xDkFS4=QaZA)){{?|_B)8Hw-q)H3IPzKPiHM2|2?0GNX^+EI zRf5>q`4yE?GgaPuK8|(quyuVfv-aF(wlXs_w}4}Na=7tnIA2P*pcwxEhcBp%Q-6rI3Rc0j@jnbz>h=|(@M6C7U>fx%lJG+#q2Q4af?@H7>c`6Fw&JpwfW1WFvJ!J#H z%4DH$Nww@r6h6K-1K$M;1QOi8g)GMGRywKGssy2=E7s%k;ESt|W)#O-pRtb)vf8-D zxR2gI3De!E>)xMZTl>m(C!Tx|_c}u7mC!FmY~hT4&*t)mO76L0VQ$Zm)=+l7>+9FH zfQZjFC%h{enbPhuNz~lx(beZsjm#JG@8B$iw_cTSX-?0fRc}lkFJafCcF=wqJsUd8 zMn~$&N!wK2xp3mXuom2=TlzBdg~W^u`*x0IxUuITUpwpCCpIqO47DsRfB}i?8mn+k zO?VOK*oa)bFN6F7oN04eyGiZR6q#;01`nk`g-ro<5USFo8#dEMz{N z)FLtwpl>inBl;{0syyqD<@D`l$#Jfl)EJHXIv_2TJFdCbB1tJq2^~2}iq9XvxA^o{ zn0YLREmF;vJ(gM2^u>gGlpZOM>hd=@e@%v3L4CC$gdajz11>;t>9B37u4gN+c2EaN z7N{PzCO`Ov_B8QVS#5&Tgk_TYRF@xdXvUjab#=&lP?prpL~g4|3*W;OC@JF8+0RZoP6YS5=9t%X5j<@=9s zJZx5j1kEdx-027b#7vEm4TRT9soiaOv=y$Y#MT=^nhP%|fDdU^7Ez#Ft2I{)2fQ7` zW7SkW?%wkBWnL)w_~|{}hkUWMk@uEt@uS1%?(3-dK@CnX)?b$25^pIgnsh^HS!eiB z?gK|C)llrf;ga;b^r9EOF`p3yYRe*y*MIBz1Bd-qR8TlBdJn2ur@`?phF`DfaY8;D zCwmvCvRQoWVlI$tetKk}o?MNTX9H3!Y@C`PXWV>S%$VZ{%|p4jHr#UH_Ryyow;{{;KtygLxrG7(#ca)wTYK z-Y0sN6h;=V$f!GPone8y(zPnL+1N>PyLSs(y=`1y*FQ1lR8e`3s=cW#m$+c=3)Tb3 zN7!8_R~a%Ek8tTvTN6~|O}BoxmiKrt8Mkh0)vSD{hV=%yVvnL*%!|m2!23pSnTfsT zwQ-^GnI8{pLlWXKtGU!5h-Pk2LFIGB{oj=);~!Nlji{=PmP~Mqtb8I%bKzXfV~y`v zhZpp~H7qb%5D%?Sa5$&Vmvl)54qk6v;W{B~UlL4_ z81zf;L5bb3SJPuc^~%Ua_>tB)$VLK>FZvy&b%*eB+g)qdbU(k_R*eJS(gX< zJxL0apH$ji6sKDr)n`3{aNlN^Qwkhtd8DRdnV96&?L&8b5Co{7; zvmmb;3CdwVs8W1GMY~|zn1^&RO1t0hBt(ULtGJTf^IAMxRpD7HU;6{ij?XXdjHv`a zw9!c(a5cYpR_vk~eKYL+k6gM+5023LHvMEY_p}y=4k&Q!!C<*zC^2Ia3C3Ji zL1sbM+*p_j602gKXP|mF$s?~%_vnUv zj52~Vd_MWnLq+!(*+*-Lw~%K)_w>^_onjFhcBsl-1z4eAVzf$ZoD9yB+;Sysedi;%NXg8B1{e-#F_eG|zvUc4YC2OlIpARjmdsP@u05 zr*U3jsq00uHQh{r5KWSeeT?KjD!)FjzCJInzFM??L^jL9NcW`?Lr-^4X;Bzlu&Q?y z02M)ULBT=3$s#1Y9wAzg8-+0n||g$cI`eH$?LAzF9rpS6h3c^3UB*o~o`&^2bx~YDhrzULrno%G+^r zq3*RFmK+#R^m@8?svWLq){v0z;Az zxet5`c$dkiO>9f|6fbU>MAIx-Kjc(r4SckyK$1&9Ug3)mVCA8Y1>GV0bcjayWKU?1 z;d6`Ui1G&YLMmdtb&4SB(ffffFqD_1Okq%F3-y=7Xr$+V_G^RS{QgC zXKOBBq9L5K2Qnz3y##l~^f-q^dVo0JTO6ysmtjFF?tQ4=Mh9FhB)1vUcK2(Quo8ja4+LSJ)Y<8ba zuA}O{%Nltg%FD9=r+$Zri;I)XEgq8j;?A9Ap0;b5j5DIM+@eRt2of>UaXBan>ZY7* zVXIJgT25e+vU`n3vm9;wD-XX>S5Izts;k7?q0ifUbXFZ ztu890yFSO?daUUr!gp4FD4cm`X`a_ImZ)oY+O^`2sgS=Z-sfHvxbI807yFk_pf??D z)@elHpxFmUW>0G7ey-bx)DpdGO}*NS(z-#}PYqNxLg1@YN}fvhUtBLqKc+GUT;OW% zO_B<`R#rcqET`udx*1pLFro0I)_p#G&G^C(J)_;ph87-;WP@^*-yrWnJiD`bUJP4q znYR1%sd_A6GDQ|qpc%2A)KEGs;Y;857S{2jmRaCehP?GUgH%@%HTz-B?uYLBrVgP} zH@h;%V${F6+&AJkBG1T_xqmSr-oU0c++uF-EFD zir8XIv!Ke#t=O)W|8PyRa?ZUc=)2$4uI5;dauysN?Iuy7nk&-rwtj_ zbqWwtQli>QcMkpbLD<<#ef^2AtKAu7XV^+t%ng>C+4%Wb9$F58#E^h`#n9f!Ps zj#E`k*Ev&FK`3R|?l*-YBQmL)w`1e~thLbiWK69X#vg3g_b_#aGcF(hyvqEk72SD; zu~^e}9oE2m94b1C2NhicobMMlg}U1!FA|mJle8de9Xe&=-H(MvA(68kA0+z|@_;-# z&(b*W+h^U$FizY_L_j1L?db`Rywq|kJ8nKA;QjfTaq4P?Nw-t8PTt*s02E}f>sbOX zogFNsq@})oI`S|>iHp=g?5*Ri>{ zfB@dk5v}dqihux<=+%{)tOw&-*p;K#;k0?3?5LDv#-^~Bshk-i29xz)oSMVH0{UfE_@k=$Td6mLADmA5HCS>H;8Elg7$zuRGQ_PzI@ zO7f{m&I)ngat~(Q!A^05yQ_P6@m+rB1*YFo4Y=~o+^59v4+%;&=jKhGbUydp4sH`1 zy;I`gK$wj(W`yp3Yj2)F9^2eqVW8uZJUv^BWHR7|G0X^Vuta6p*nh6WK_UPW?g|4H zCB73}#_XrDiYLG?L;{a;A`xflU$&e61X|e>FFS;FXT~~Nej^;8D;T+(JOGZ)-YCl! zDic2c`~DhIAgQ(OXEkNRICxKJ<<&$(86$}P>l1x?yCEt=imFk`Pe$TW&4$L37fnx4(%*=smL>0uH114m_}1+sdfuU!A0Zqzr@~p)h_Rae)3fnObHlP6C?me#TrO zCzi%;E6iC);zLiV*o22GEXIF{NL2tM-wS{K&aCtKGNF+iOQ+JaXYw|H4%FRB?7R&T z1KbAY2p!11zb8icU0Q6TPkZCL#ztpG;uZYw`xg!FyJfa%ZgI;OhQyI`fsLCle_S+t z4uqjjj%#Gy0#Ipt92R{W{euP*jXIOxh~qaUFM9L1FgE=XM~3_=Bba|6C*-;_c4HdFiehcxh0 z3i5W02=DV{(OsRR{NTp{O}%1D0O?=QOrHWG;?)^(Uyagt?*2oVuw0Pnoh8{=0EzL^H|PjFP(dF&|L7WETT0GcVgY_ zx1oq}^k1#{aimB=*)HzvnsDIHm*|-4-oMfmwO_ThrZR-9o)Q(i2K8OOn)fj<5|I>i zrMN-NYx$b70)BeTtJLb1l@(5>DzdL{44E$Db`c|6v{j8rk`njaT(d`!Q+zvdV+~uc zwOi(`abOznKOr4><!y3?&Pn`#_&3l#Gef?)=p3_f^Ui;vfzaAOR#H0C- zC_m1^677NRcZrEQlhb%^AG}2eIicl$V9+BoV;Y&B{w1=n5~3`>l3tCJ_iei91O5sJ zlfRNrKdWsWxAWWhrxQmbuci*ftO7n7Oc}WO%lj>uVaUiDKPF^(#js~|dl-WEB(b%;R&%wBZo4s*Feg>11~T!zk!KqRO#H>GQupBCvQnt=r+5tC~|_jcwZextGmQ=bxnE*pJAI!;`6FR9y=}o5@Ho683hnm=2#mq1!K9 z;~t#M?%xqQa&ju$A*O`A5Y;)3bM=^-yRtSfb`+m*&?NHD1^&k_^1V`zUUp zBQjO}+aSl}wx4UqTg2FEd)wQlHv^*CRVd!3FhGRo(ku4))jpO12ugP&rZjKiwWfRW zYw>!=HK|cBWxk2w*r^o8&xo`u5~q#7C$1%JvzI7GnjkBxN}y~)MsK5FzthqT)I+i9 zLQUJe#tLyOp$}IIr$A@HkBqga9H3%Ak12)kQ{#!2%+*+9#70XhbyV%2UkvY~D0|mM zOicCza3cpNf8-DDqMQ{MkW2mhk21pBOx#yO@k>+nz1ZeIc+LzQXaBES&Mc^@EREx+ zqiBmVE)B9tyJ8C(1%!qWVxu&JY>L`J5QAF>)IcL^2uZMMRMdci4TdEsixgYJCJ-=e z(Lp2&ix5o$VGm(RSON)Tn;Yzh>4%xBd6>6bx9&ano^!tXf8ROv|DAg`e-7-iRZ8cm z=ml-2W49d)ss}v#)i{V&<{UK+J~DWlkr^ixT(|EP4_lGEv+7l6mX7 z`rnoA>yKLGlLdp#ymRS3uTeX~bc`pDe>eR8u{uRKGM^xch?2hX5Bxxz6(kXw^chB# z#7h9KbJ}H`x6PI{mOk`b>sfNpaaH^>y|DfmqK}?)K;U6OD{UDN0WtzaUnVZ#(spqZ zVUr8UHtKKJjt*vN1d8xgpq!jad2C3(uDSb@6AQqAzw;SdN2f_9m=Y%6(PT^t2e zg=!ibR|V#v11NDo)>*m?5o>hTQnM~G5obZpgu!tGj(YQzF70x0uAV}pwc8nXX9bNO zbd)kXD!8@U4%A|o<87&s*`|`dnky@hr;;ZAo2~Bu2g7qn%3zfDbCVL7wu5 zo6Tn~<`BAK((ct9AG1D;F6BcA^^r>vEU%LrOxsOA%-~5M z#X&|sFPm7+R$g01eYw6pxAtP}a&bw{TPi%16;?Qf0?g2_F$#<3}XnXEmOcm0X z!{Mfdfq*I2fU-a1TZs929@5Rg{4M{z@?9Cko|M^ReIRLnw|jnGRaL}G1ibFOa|A7s z+co|6Dsuoxs)B@lW!!Fy@jnb5RF(!^gPXPin?1IG|04fYi3yRqp(DWls)4f1ZERc>4-}4==@QsXQg#VCX`Pjnxeb({{Mj4zJ&j-1gzqTJ&ZexJiN=qXShYkaMiouM$* zihdgSA>BBh>UG8sz{fP)%#B>6)ZZ=Zve3ylD#}%J_s_FUjp|p?zS5nme$D^s9D%?1 zd2a%1f&hF>jr5)w_Qg&=>>L|+n_ZGJ{}HuB-aWy6I|{a6W`Hnb;cfm6{HJ~AA5ZV+ zO^P4X_D8eT5KMzCi0L0n3XE^`Xqp2~J~>=whP^9u!!3KaNy^5JOLz)Qwu7R8tf2ks zjisRN+T82EvVNsTX1X}xJ+r&E1Ana8Qpn2QD&fVB#c4QXwtxn8H8-fA^k_PfU1K3X z>IqazcZf<=_}R)j8P@aQ7;I*x%o;+#m133p4|1XdRsx)DWgq8qRCq~o16CxrvV~U` z$2#Ub_snsmq87&UH8fBu1S$k8W-@S#nO1mvLoQ#oa#qzo1j5WsbiT7n#x9E6xctup zJJ%*Op$=MhR$JZqbv_dwGf|=jmqw4H=Qe2mw@dI%LXLx+E_G`7=_yvYv(qNF3xrZR3f^9WzweTrZ7WqEQ>&+*-xiy?FBw3-ZWJN4Th}bQmbtp<+ZqlYjQPJ zzNJfa4MuhJC8X&CS?MdFHTA9?=isQw$nkr*(2+Po!G*E?U$K}~)F4_CUzSe8@O3kZ^Er5IyP;Rw( z35J!UL`-m9!A;qPy7nr*dZ@-uSCrN8P)B_V9{n(?zi#F`+gKxs#*j zIH*Icy{ipTSyFy2@?sB~?5qc-cE2IAHt=n!gOV&jwpC}hxH_Kx% ztE2W0xmBmGr@cJg0cyO-?r1X(kr9xzu3+5V>1YzBtuK6Ra+RToix@7>2?<#qlBORE zbPI%~d_ybB0wTJa@)1vVt^ENOxF^N8TUJ5l82Ua|j9w5GM!ns$6;8y2MsryfV`-qN zEznw|%v2>{C)I{qY-dkz`?}Fkw&fQ zBN#PretyOeaJs1{;WawCpt=$SI;XBPp7InnGa1cDG>a+B>Gj%*6DIE9rWl)H8{q`X zVd*sdD=SM1z|Vy6zDVL-OqDUa_)7$Y%8SwTNc$fK$`(EpOnd?|qD%^KF$$pzZLs>; zv5g|58uwUn(Y{xXl&jn#G4$KyOX%KD$tr1&*MWVUnx;mKg3#9O_l|8-Q|n3o{>>eu z!`5^oYumbF>)9rC1!*L0!jnc)RWy#I)ou2c_^7-jK29i+|GW6{gJ3&?o*?PGQU4@` z$7-B=gU6FGBh1l6I?5Y{G*rvYh!1zuM?w70^DH5@`^PXicUM2_WGwV*Cy$rqr&KUs z;}joZDc2XLy+|3^isfRqI4kTS5mliCSf3Z_X+6tS(ggtRztKx~?*aru3zmUEkLmby!sE-ZloZO_Y`t>6Y$Ly1P@lk?ycSK)R&6OFD*7$sq=57)m6D?#^$`jN9!w z$Ftw}yzlq@^{wmjQf8PnYd!0E?%(f@$3O)+@w>P1Z=s-|+?A9NQ9?mM?L$Gi>i)-7 z;FZH#{oBA_R~(hZpP`gM2$z8$uA4oTeTsro7IypWIV$k;%@-1yjwmP?PVhfhrcFuQ zP*C1rN{T#HanoBrM|UIK_dfItqc6S?i^K#wb=ab?`wf!gEn-xkev5WY+aryTcai40c^)|>K>E+ec<8oTH!6Jvz?Pot=)BPAz*Z5>N7QUnkVti;^*btsSu9JUB@m~FS*n@cgXc6=9G3|4JYC@2aKBbRSEYonlO za7Xp=p9IuQxwVwM&PZnCJ#%x~OjH`hZAy4prD3VfDMm6~t%mQtl1`0vY z*HSSM%jBKyrWm|{+j6?LEI}Y3GvqKEDtH)kdJrmQRpWguolR0j=(SSeI_c4Jel05F zE(*$y81yR2r!Hccg3dmurS^Q(HErm&J9Lcb19agHm=hjsYU3Xc8JP81a5~KKILPL7JFyC z^*y&LQk#x%OoY^&&%X9NV8Xxp!e{Yo1&Fv(yp%lKzl_l9%%8x6n5Y`}aGHU!@%d=C z%jwtMQ?X)wPTTQXsI6($fxrBiWKUnp@$!V6r|EpIV72dz`))g5bBFxBNjs7q0h_?| z+eB8$4^{il7xeGQr?`&Hv+-V>O$Tf^Z*KOwdfAV%mO|c1H&BWl2sj+taB>rPpM2Ks zBTjfYnw03!%t6XgR&N&9DCQ*5^#-(%(Jz$S5s>P!v_TB(teM{aHrGek#kJFI=zD-| zcF#h8!oH(eZMS`5FU^Vlw!V6P zQzEMlGS7gS9xjcGDfav+vr-4~BAJaDGUC(`T{j2v{X^#xw?pNF?_27&6{QB-d@81T z-jvQ!gz*74P}1rns(}HmjXUJydQr5B-n6IgyBo%&<#RShWtQss{dV*2*RaN!muBb} zZBwb|QQl@PVS=EU>8^+Z)QZ_ATzx_hx8TNFo3PrwHnftOgs4nG#~VdD!^6)nyJlbO z60GZ^q1Vss__}XBJROZK>0Z}AUiyRIlw@c7XzjF`2{syyG6|e@>Q88&&ncr@ zyL*nFhnc(7S6a{Y@q4H*1@~P-uU$@Y??fFAT^^bIgMnpt^lYt6P)Fa+jKb4p zZ?a(y9I-9h^0XbT>Ehd`CI8bVkHh_97f{nGrvBL(!@$zC_yMt0=!XydN3CR@_mZc# zzSR&{_SqO)=z+GUr^3#2Z|8}7`RJTNUqcfKh?g2YU$bK6U3AHNE#Iz@u-ounY9?{0 z-hv)})tBIH+I?|E1_`mA!fP^WBqy3Y4a;XR(;wR(FXiVP^nw}5Q*d-Ej6L8FeIGK` z%;B=&-IU%>;#5Q2qwWxVl-YB)%VX;np!}q(Hrr5%~#e840K*K^J zXcHTx3)+WF6rWzaCOLOne!#;jc)rSiKz3TfJ8HH{jDli7`g34i??`x8>?ZHGakeMr ztT#S{d9E&*&kEl+Jr9sDc9uJ{rKTST%iDCs3SLZK9zkHq@v^LBWkl&IM4ozkJwiOb zFJ@BFr3c!#LQ)h73OTLoo<_E(o`IQKgW`QBL8B`n1TD=mdM|4BpF!RqRe0{f z!}sj9;oIzeC<8$;nc#j@&rR`xcC?El2&4SX+3Fm*)tPOw4vf0Cqe0)YKCS5&Gt~@r zw0Ch`M8b9}Ac`y5Jh^pQ;}Om0p;gUQhyK-E=%sI<`?H{G4fJCE8Bg0~Yw`eyyzlZ$ z0{*b26E)cV%nm-^VM5cm%T8daTZY4zIv?Z-=4^S0c1e}bT|tl0Q2xF!2)*JqxoqPu zzwg1BW^PPsEACOnTf)3YM2VZz=W7+7O@!6*ZcbkFflHf{n<}Jb=R0k%wKvp8K{95! z$pt;c_|DCr`-q29D}0Jo1$0`sIRo}!YjT$oixKNbi+kz)J?`?l;~g>YNifUW=0DG- zYBrDfcnL$m0;t6Onbp&hY^G8DV;IwC;Q3l8RRB%qZ4@Cjcp0VdUOW2yl8X4`m3NTNM5AZhNpzK~ z&uW>?=+MOHR+1U}-QJq1&EjV(W>ck82ABBmrymA;NF&-Rd0H%aM(Q(##X91M6JK1h zncX~}GIHf%?%Gl(hQdac_|HqCK*lo7_1hODTyeKpJCZ``dDdph+Zf*EjY@iNgKfUEl!h{(dmX0U zNbz!;kR{sBr3x_OwFRwzHcMjq+Qd^|;_NSb_QkcJeIirtLHIsFi9?W?mw5}-ntn@w zp8ke;z?rkP`_|2xrp?dKrxG{l6MPoj=vB_NSmHOjeCA(FV=LXNeov;i7%CAVc28G9 z@mmb6hyFD8B|rL1Rd%Mk%g!+s02W^9s-9O+^623Mj%Ds*tiBicI(O9ew4&MLXpmsU z^r71~MeXK;ldWsM2Wu6V=byFJqzATP#3zt}Dvptv`red+?eANkC&_Tz^}X6lIz4QT z=4|gqkA#pk4_}<`Z8htj)rv+ko*pr928n7rCSsBi*6(HW;cM+m29P2} z!v`B^9BA)Z01N_^hi#`)S9UH|+jgs0bD&Dk5vERZb3*!ZH>T|x0ZVYP*VcijfX(_@ zUGo`;5LO${U%N>I@>!{7n%wXrt*M;e83%!iq%TYl2Q6T%O|_HmG6MnCTs1}_o}a12 zmX_+frrnPAIVWAZxGn5czTuRDpLn{lWgd>$xrCl&94NcW4WeSC4<8m=z>K0w~a56+P1wDksK7nRmdn4Ee zq=bJC5eDh$Rl;@wG!s7z9W8A>EKEHl7uX-2KHbtCX+rmz6ZCCyq+AJ}JL=rJ9XaG> zc0_4LFR^}Nqu(@GPlJ{U<%~RiBSj!!U+O(`X~9)oy?SiFzO8#ni7%Pq)>~AwwRPmE ze_7!j-)1dPzAo*;;{0NBCUkzAQ$uN$Dg)j2qs!sZXqAq8_glj4a-dQO+U3WY9(o@K zpZe4dRjqQ`o(k4zxSoPv&Q{9ykqo5Z$7Yp)1U;p{WA(VZs*`H@nl$cjcABq(>)V z4s?5N_!w`pHsiSp$B%E%>iSm8TTbt6;YQAcua^$WT|6m2^lZuSvvmlU-t|Yju5Ca5Cb>mVJixq34`PMiwUGtt}AZ4}nLGr6Kod{&6Y zL23K+JOusXTZFb&$KkZ^W+s%0(kz*mg_oJfTo7q5DSX1X@*xE5(7!Q*j*vk2PPuCYwgK zvyhqQUV+>`k?(d+J}#z)d*3Qfo3=a9DO}4r_BxH4XV_0)Gl?0IWpq%Yub)OOVcJzs z@5FQn_}c7jruw>Kr>!mumWzMqYjm9{gbh+4*yAQFA z`s72sHv3!!_uuPgnCw$EZFA~3wt-&mR~@(I9$pBYf-i)lQkcnfn=dui!fKp`f=qMf zGFt>Mv~3KG=W#P_DMC)VM_j%4>g6vMd$p@|Mu$n8G62@#JE88MO+eyvu>Dd0q4p}r z*_wDCKkHd0uK2x1i}li`xrDIGkxl>2S{v!n?{=e@WS*C+Df7D1Zgah99)mCAHRME+#PX!(3lN1tyq=wT z4A#BN&r~(!hl?8D-(8q?pbPBoHJJs7`@|k~muzS?`<%BY3SNMFYl-# zSpNE*;$dCwjgys>^i6)kf_KLvz&kOo>VZ$g4^g2h;ERF7FZdOpHo%Xx4-x>mh95zJ z|G&Qk*S3oEGcz-Fb#*srb?`S+5oBUZl{ ztFc@4{$KCIbmON+V<1@XIkP&EV_d%Z0;RhHk5Kd@szVHg4sn+t6ke?YtZ=e*eNt@7uFX{LH`VP z^yuQ?DeNfC5hYr{6eFhO_!#y4>pYskSNdV*DC%HvK6rS&(8|h66ttI=%Cy&vI|72Om90UCr7>1mT5s8(#7L*CZeotBrN>eyyZ1y+y3kbcz4m? z-vfEW9v<~|b#Ecyu9c+N*w~Yk;0f+g-I}NLF)?J~p&BI4_yh!^1j|KeVf%`?#l^Cf zv(LTd?p?oHTwI)S7k&r8o%W^hPxSYbLb=HYu?J!Y7IGNu8gRMHF{b0PPqda(o9krR zfCnMf6Qi!TJs-u~PfeG_a3P`Xb)Ooz&ok_V>L=2FGr426Yed6D4eK>rI!RThXoL4Z zf2^+%$BEOJta5P6g<@7tw5Ju^!y9>3s}{sORA`w4DiS%(2m&pAJtZrv1$}_V7~jip zOlV{Z8)9#aa}htS_B@PZG!k5PB|W?gp&jRqcTImZWJBXR1eZCp-`6w51l2PLP|JP? zM$46ErF!W+LZau+=Gv}Q_oJR`^%63KCl{3lVv+O3mipCrU+{*qhztYzH!4Ls@KlV9 zp08Tsu#;Of1_r<4-;nw|U0ANUrWLkt`PuyYD>oUUo_8iJG~f_f*>(A;6&+44G*3=T zbFcz(rmCcU8N}ho36_>(W3DtVOQVP$Bs#|Z* zzeLHps63DlHS0g@i0LH|%|vN`Za4Nohl=1@0dJZp$=57}*hGUn2NtW5n!(AZ*Vktm zgb#drNEu4r#HCy(|6t@_DQD^g*UbT-8!9iDXT%o1zFtNZxGX%fxzTzQd37vPC2Qk_ zLtZd{996+m**lZV_Ps!9M#nrmp<4kB0ZJL(mKp;pt304=i3{bIYumgICnbo}q3k%= zLnN_OI8Z6hEj$$h`9sW&(#zf|)4A$uDQX)jgtU_L@|SfKiabuqpk*}sBu(z^6IGS& zVGu<$C;=?*AyPZ`c)55`TYzyxjnXG3D*#(2~YjfQBB=%Uc-N3od4ttKbpexVfi(dnjDP% zP)qx|aoO*D;_YcU(mOdDB9Dz$&}67?NX@m<*)uSEN{rrkFB&Lw@4G-`4dPsWuNcfI zBg&^zY{;aN#>#Us4ou&w3Nr6q^XFxvA=R`H4b%#FA1tlnsitVzCpKBH6?-hTqo#US zQmfRH!n0Ebx<;b*87&`E?4wSGru(E;y7_a1h~btRvq^RYgfcZD<`*=R~q$@dq?Wh%Bt%nbs1AI*a|w7 zm4RUOm;mts1-ZOP?fOaDIt19VbY`!y%b%Z7U9MYY0PibYEos;ZqDp-qD5jY%RU%k0 zf0A~;2pBOERR`qNsA0f|6F7vJ;leEZz{33b5<`tt32|_%Q`uU$a6!E)&g$#u&Sqis zjAgY}3tMtkROU4yPgRMY6rtJ|V;SYC56ie}1|EoFyY{CaiW}OyGFQ=o36(tAJ@tw6 ztvs04Ll0~YH<)zWeFiq4Z4e~I?>kj@U+>ZbVPZ^wLel_o!6A8pQE#O`*m*xGm2yt|-dK zogz9zqRwH56>=3Xpz*o*i)8CNc^iH>-a=8&G;LookL4Cin=-g;U{(gya0yHQBN*#V z-+9Djl$3?2p?)jnMYMI&ZTFvgu1Ol6gztlRnVYgu4ydv7d6NiN4Eq)WX+7u-$D5hG zzejcxt`LNOA>B-m&f|^isE63nL>{UhSZ^hY8QNd z%9wY=@rL0}Gm4O^7DVQ;35b6}ESjs#M4n=;_g0~g;S$;%PlI=3#T5TN(1vIx?RG|& ze?9D=$d!>9Kz$#HT;vNmrq7>$K4ItKfesHZloYtZd!?*Cneqz4G95ori}yN13AMYs zw@=c+oYS`n+4=%iskM8R1uwzArwQi34YnZPTKkws->Nji~nkb z-JKxW#*N=)Wo1kCrt}!YlB73}wlQU8L+;+ai|AZCw&yw$6A}pUS40VjfesufM~jO% zJXCarj#^q;E2~VlFdf&a8)YhLd6BDOKe4HUJCHUYvD(XAw|k|Uvh3E)k+~7JUI;{P zbwQ};*;OQkIPt1B?M0N7QYl{P~Z32{(ltt)fva$`&O@I;js25et z^u|d}?fNZ&B|_gU27y1YynqVGMFqIb!0}1ymy(7o9!I`}yT|?LvRaAB@yV_=Xo%l4 zc?lGXp&^M;o&Jqo$9=ST3k1{%9j8m#E;|&?kFc>5r;=f58-FfQ9GaYLD5&n?feBtL zqZQx9J?999Xtt42MeV`4%QxS zvSxn6oF~cKdM|UzA~2LWuf6@t$S}R7#DE7TE~@8b%&SIqlZvq_;??0-{jI3mA9y}I z=r&f0BuGqvrgGJCXGuOdyt*1G`gG9nz;-B{QxrMhhcmV+MZ?;@M`Fm{VbG+f?v6~q zn|1Z3w}^WEF8(a3T?nOX;hQhz#`u9l?S!oJvOxp}ol}Vpn3zN12FD^2R@LN#~aAA#Z%DCzEEK4h?B5E47AWNEtgHd_*&qz=gnKjQADb(QFEGm z=k_MMV*S*9_G1JV*GIwaek=EA`_b5Fq8BLfUVB69jYkY&0#7~Ny2Beu93_J3W-B$N zeR`OMwW!P{pnPjYKU$V>TTNAmijMm<|E2)R3pki=YaH0gq}I-}1f1N+deP}gO##jI zr;x2Gsn8DMs(8O+7&a3z=t_b2I)M>89E!MRKTF4dtw7I%e^Y_L8MHScesK~fXOvdL z`=2Ozb0TD9L-K^B?@HSb5*`W#=Sp!`IlRVIIznnIDh(#t4B%IkuaXtBaMNNuZPnMb z>gxG@b3a8e0FAuo#Ut0rE=Zo?x_hqjEly%-I#sJMF)*P+#$m_aMjrpI_IxdZd-zaW zGc`q9xfmU*O%H4Pguzr9TjZp60LB_Y5@O>;=?#C+5|j%@{;B>rwE^`fWpT_*B#5rR za!?D|4jL=|Re#)ZjA4XA0c+?@7 zrL9%1YoxjaPml%ZLv8RuCq9{T0U2^&Cu3QoB*ty~svl6uS&zTQ^{lWSmUmzUI0I`G zH4RXH$_lev+b9b73#qHj$ZT~Py1gje3k&?oi$@zH`Hd-UTq2oFK&+{qbykpzK|3{Q zB@Ob#(f>ppxZ7+8%_td4ch)l=2>hNm9J8jV&3Mf@_XB6hV@W+xIl8U?E~wpsh}$8n zv9YnNOtCV;7EmmztE&-O1T#B3_8-@^w6zfs-W)|GpTh51otY_I=_rvyH~gVG`u0F< z5TcwEJhbSh5Q2VxE%X^!-=$wG7rrN50kSc`k*4*V2KYBG*~?`NETlx4Ygux6eYqg` zZ1q&@Lt=9A?dxj8(VB*NzL$mj&g>cX{XG!KjjJyc5`ulwSSp|J@`?jgA~CVBShvbj zwHQeqI61YowaxZJ5kEa|d_Fwf&pobc2|I(9Is;!59O8&^{H>A~UK5h8)H~E#bO(%7 z71>&06own{+sY2Et*uq+-D{;K2P(=U3|8D{W;Ie&CeR$DD&e}f)DI{*i;Jd6fydDB z%gKw8zgWun$ukL#+w$k;=Hx&pCRSJS z7UIDkZ9wVOYpidSA>oeuv^__akbqBsk1v9##B&{Cob2qJY(v2ud_Vyj931TJWdLfV z8mzLia%fcD09lwTb%t!V#iwvcqA9n5(vvA=yYON#_RlsZ534sy@DzM`j+{*Rz-0R1 zh@or!v&7~_A{)eyk$}!zc1e*j9Dh(HxYmnS2 zQ?TOqoZ+2SHlA=}foXlWR3%eEZScKDL5yHfaK5hOVmP#L{B%b`chJ+qwbBmc>buNx z5aoj#$vGD3UQxcaCugdTD8y0-6G)(9oV+V>Vq(T`rTEv1l(+=1Nbhl&{ZmF_ z%pZ4@l_tyRMfXl^JQIk1AraetCnEB?X9k#F@@By6NbZfeRO*SSr;(G6pvUn6js2L2 z^_XXkn#*wVj$e^_4L8NQJTu76fiJj8u*7?Eza&)LEAw_IN0vR2%Af*hI`-BQ|-sIu32GbNaWR!8W# z(^e18lCO$alRw7TJbpcCPsf`XR0T_xqnUK0FIFk$$ER@Y44ftz1ZBF6J;!ZUZFwp@ z(J1m+D_5$d%9X#Gt9MzRlGFW3fC!h!5R#C@(EP6}mRH|`b?R-&TlvSRtcdGQ%fJ$- z77Y{wt#4CZm_4n=d~o`o6fe-5t_%@MG$sGvHWgjoZV{Y1uvitC!9`TPX-tCpIJbYN{& zxKz6lvqs8lQ4!_EZDx-XA6ap^ml(rgL;Jc(kdfQOFf#U54)Wom=4)zbeDnzk4RvvL zt}CQXQC{QlHdUIAu^XhvpC!YsqTDz;d*x%k6LNSJt=G{In^tspzRzdJ*H;%VP!+W2 z3SeJ+!Oh4h(-99Pw6L?Yv$n>v$x2K~DJd?tv9iLnag&jiMZNlRWJC>t-JA2^D6_tl z^`)iz>x7ZZQtUYl3$H4(U%_jW---y-;b!>%f=Yd@j~%v=HN?g!>L|8INKQ_EDfE-U zTy#c|0Tm^`un@B_d}FCUlYxPux3?EboLXB&00%-D(@sMZC_hD`^MHm2@FpZ)DN>B0 zy*2O#ILvPW)}*Z`DP{MP+uZ{KUF%tE0P!Qnmil%U1D)yfryl#om;!>Ojprp}Sco^G z(E-hDa0FxNVqY$m#H3NzJGU&Q8A*;7-Z)~!Fdim}3@WwEVjj%=p?7=W%jBB1?xT+d z{%o|EfKjuaB;@TKqC%!dI<+=wU2O8B{yuk>OCIKQlH)+QFad+y&V_2*wkfE|b9Nh( zIsi!=7R}H_Z5O+^I7$Sv22GIho?vb+DH zJP6)BFnqZ)?mN;%hrh7QnpziCncZrC1I~ef=N9u9yERF!25LrxL^Gonyj(03v50h! zf6BQRZ>TD_7`|e=Dz)BfdMD`i@YBr|oxKkrXYyE=ImB6nu=Cc+7##W_O-*@^wcHgl zyh8zrqkyU-qNd>OTIX~KexxXJWvF19VwhyV5iVyloo5Y2`YfM!Xti09UN5ic1$l+Z3$%;>iTx!rb0 zULiG>g|rJ?byj@y33+{3zf&#nGG-MrT*_i!F-RHBhZoo~KrJ$1Fx)-ir~nwgo`;!Q z5#l#@-E`3!h0yS9#HP$_e=X8n7AOD zg^kMw-{3pMo77am+Wy6SH4i&4Ec+>N*E3`X)7JSQh2N(!li3Q8L7+hgnp615{MiP1 zHL#zx)Qz*UvlrqQ^*o>>=-xLOOMNQW@6ri!2U(>p{lEdJYE2fz89qVi=EyTW+zU zR>$w{Baxi7K>9eBVOu2xOPZchP5(Y%8FtSqTu}~p_zH-&_uevjA=h7;PW12BY}Z1$ z3l1wF?C*aG=tNwKU-@U53^uu#$-KwQWqZm**gXO*5mDp!s}S!hm`G^jC}${&26Y&A z_W>GtDdpRtXAuAEh<9nPTS#+Au|aKc?KJhK;k?*@>r38`E5!g7H=s_gf1!Je#&~j3 zOCF!FqT*+-^NAWr$pMFg?LXM~1wm%;ewq~j9)%^Y70p-%n;4^|>?G0#pRMzcn~ujW zgn#Z)O`Pjx?%}kjJez`mz-~P6W*y8iqwE>rd|!PjWMx%oPB!(A-t-S85)L|kufnUN zX#lTU-5mP2`&=??rI#I6tCMcAHTtXptNIP9#dBMiYR3B-s=|gJ0wLS8E^=v2O=1NP z3d3z(Y^z7g3)Cv%Yvm(PE@Xv(hl&6h7+6lKS1oko?0W^--mdWW6H)WHtH zqena(0y+4QqT_Fuhe=z5r={)Lm_;gy(N1O6c-`*q#sT~Rprp}TXfE>^1em^ z@ZuQlS6JF)dAM=;7+>@Ycc9k`C=mi=fXog2_$^WE;;~`&_aKY#(XAu|Xwm?$@w?cH zm$F1GZ3Rg^q{CAqG0?zXJQ-a)X?EYk{`1B2-dbgwZ|ro1btIzv72A5W9xd!w8ZM zfhDYjv{3U57gDQR|Ea2K<~(``s9Q9%^9nyc?F9UmQ?L?UiFu7iBVR^?jZDx%KL67) z7BHU5@JoZrG$|wlNb7nMMg2>m#c34GARf!YKrU1i{VaxHn*O}UZAR0W=nr38(wB(1 z9z1#d2jUWs$ZWu3@Fx5_!(%&UKzzGH^&0WmP&BUoS%X{e>AXL>LZ&&;mVVFSN6!+j z+xz9qt9>gcr^>>@Ze7*wB*PjD`@r&suA0Xok`clMS`CBPy?sne0hH){>kQiOs&4f*+X>FIii<^3Tg z#n#p~9Z?~(v$LC0AmEHIJh1vzj(6FQXOlz(xYptM9uhOZlAr6?`IlCEr28dcIP-LL zoSmITkcp2JX)3FC4AO#tvaFS=pO~14^dtfUZ?3jzDl13*(1|Fu_5WB-Dk_5fNgm*C z`OhSc{f(t^W=9XmC2W3~+p1!B*M$&itpNT@caWw=xSsdwo4!6PyXIAEczzW)gt$p< zG?{G}UT)}b?j0+ROprydSpH=&Pbk$-)-&W@l`SRVWl~f9h%f1Ywq1+;vUp+sl}Ug3 zer@=L6*88L-G$C)SZ5PNA?(>uDW4Sy55SRPauXINCgw z3`mG1^w{^1$_CZqYQ!y-QC!7s^u07KtHO_Ei$S)$ewJTkGKzjtNVH8{`|HW!_|kkP zGM;kBZ61iOfcYBcKOr?s1!ka+X6?9Rk(~5Sqv2M!+~4;Gu{09!42cvM_mIiWdJcom z^cPng;}I7u6i;_qnXMhIWiJY9TUmIpU}L0IDZhR*C`J-)7GBRhR(n-;yWs<=YA9eS6R?za z39lg~N7|b|+lL44!Q4Zf23!wi^!6@35dUJ5KDGfvxPvQn-9+Qa$$UOZ#5&pMy%sR@ z8vz_o@Q_MbaT~7`ag78RA%Z6-KI*9J zdk=3+U5c^=8UKe`GftW@f}3YNvZ-rD7S&s_+VIdQ{P@+*{Efr;^Q9kE($d;@CPI1F z5IYiQE$A!2z6&iS@8G68detTm4m4N}qdG%oYo_(s1s>zaEd2276sQm@1fUc3>FG@+ zp%5_8aoDd6<@@{J04O?7hxl7(h_0&*ru08l*k70f*yrzxrEusY4Frs56ICC;4QHC^LBg3uSO9cY?v)Fk{Rve4!L zIh|cfrhD932NcF)3`VmyM#wcjS$_T%A)Qm*fi4piK zNG%{dRY^vB&qq}ox7X-PXfGaT_BTq3h=O@zLPlyHW;iPKEFtw9g}ec2Z85`x%CuH% zAf+M{GB!YYy{_!t_@<6wH;-;7o`+UkeG539QTjzk_nVy*Zsbx4S8xD?=TQpfRe~PE zzzl0wx`MrYQdS(rfCk4`-^4gk1*g47muU8QIs zbl)W83cI?bw!0NMAzS5@zP71;k+-;YFc(o4^rd`yu`to0Yl%Z%892f4{75|UZgeM- z5q9d+jMxBjilqc(mGD_)mbHpQTt!vk`pVRCte>R9+7=~oH*5(x10G5-+mv-`51ZFy zbqtu@sdJKLO%89%wpLSO4I5ag0Q}R0e34y(;YhJS9&su=B#NQ}&R$!FwfZ`c7~J>+ z*C=l^KhH35S!yU{J<6cwRfbaDeegE1vQB(?TXq_e%VT&k5}EpsyeT}Odqv(#e}WNSLsXX|#4qM^5(OCX zv0;GRx4ym}5)zUT;sp3DRaI3sHZ~b|!+=b)(4((VC@maT&XW1uch<%$h=_r=(pqJ+(64TIjLi_UZ7fNiR_W; z>c*i^oPpsDQ99}sQO8zVF_p3r;=PjUJVH&c3 ztXlM}{=d>lkVy9ckz)RtX2_IcL_DD1Bsczw{lOr8pb13v^D7sEmPg8^B zu+-4tv2m-LI*y{CzP@3S%2lo5;T=xI+Dl7%fwUo){=}==4{E7Lha~3I@Lc`PV7F6lk0Dch*+& zLTjd`-XfCK71T6fA~P5v@ zwe}q)3=_{C|8D*ox=44fnHIz_`t7I(Sp-j)TCQfe%Z!yhoXf$Q%pzBcNqXOcDoVBZ zfwVX(j`Lb)cauBf8`Bb^^`I;m6}hMsrq|pbUbAeC-^kXGO!RcfD>FW6O^Vr6Pt_TL8bS*QSUbok1spKPn97(M zu`f@B3AS`5iDa>)>{qi0zbb3KCl1a-u z`W2{TSOklXmq1zlJ*FNo0<}+Bu?=G|CXauD>a#7X=oMW%Zydm|;bIMpEH~lg<}$N~ zIJ(K+@b=Y-l<94J8hRU#0@*Nj$^H`^eGf!YB@#WOiD%|*6!CvCV*YN4{NI2+9Ygpk zN;3?vR$(2$Awhbdm7+>PzrT=s?3)zTiIzJB*IeiB ze1%82N*XPlz0-g!_pAL{cG-%Gia`(VpRwo~fz)EnikyxsA zfiE#JTHH&z>;n%vj+nw=>s)sb6B8cTz^?fCsPSavW@_r_w9n}Hd*nVRKZj>XX=$o? zdU-dqs79Rn7f@8F$#$x9)|Nv}&=YjgE21}yIuB(p{Exzf_k;k z@|I*~`Sei{ovr|#!+zqSYAj%HWj*tCCQW4eSsW5ep2sepN89 zc8}AB`%lfQ>t%j^X0sQ<67;*}&_UEJ4pquW@K$8wp&|Jbn*XwjvQ=u@fIxMX0T3=Q zwgAG>8k3rv$Y^%RdudRn_r#PgB7eXW92q%j?*f^<(;uE?pfNQb#plPIS8(n7muwf~ zendM75555+qcUQ{i%>S8aiV5Ao~g=A;qWiY>Jd6ftV?&k*J}Tg-z_rq7?7zdg^Pk+ zs4(vfN~u_vXv};##Y{{TPQbEf`p5`25(ffo3M)7n1#I31$r=c3RmmQZ(SDyk{o$d~ zE zP~2h+p&5sT(E2>ry&!a>$>>*!(IN$rQTDZIeyxP8SZysRVW(Iab} zWu98km0)kVV2Txmyb1|rpl!vdTJ6TaW?3RtxicccWo~{gB^Z<$cqWVpfnW2W4emEW z(B;&;w(r1>5|^BgND2qcJs(%`AK?5+{+~Nfr3Gu&@nM(!4KL|W@AScWH;PI)@5WK1#JpZVwXm|XGO!w}s#Fnb+wUDa8fC;f$y3QckY`UL7=2`i?%yvE*DGCSWCqz=|Hr_5R5yxxG)E9x0Ig zF$Bn#KVz|_g@8-;r+=3Y_;*1F--_39QAW0x7J&!rC7|lSY!(qx4WyW@^3$aId#e3^ z&!qdEevXj!H->BEj?Nkm4nP0|LzI8P*~sZpjIC3PoD$^vSO}o4%kD0Y1i9Eu#5=MZ zV)IevQmWUK0=Wh3^;4=N?9$uGQ8B~ZK-ge^-$@SGRnr_FA5~RV$f&1zxLPvtD7Nc9 zGF!k!r3epuwK(2oYGkETOXtzS;mY>re+*v>Lg3oD(3xN)1S9AOkl99p%J25PDANqv zF#oTZdhLsRBF$gh-vS)?|A2*}kdQZ_^cg^QY-L~zqk9xC5FtCoV9AUvd$GdupbAjr zDA(_=W=sLQ>Nx)->DIRQER58zWRQLa2o(rW9rPj>`f%3& z3~7zmB?z9(D{!SU^B^8Z8cVbeG^4{AJalq{RXl@w0yA6T83JsCqqnmQBdBeUAaoCUQCy4(yz%qwVj~CIj|`+;wBz z2&LRXuaWDz!XMKH>_r6j3MR-88QK@jYw->mfidcCdNhMF&oXcvC7f9aGJcqrGXH%5 z?mg6j9Ndh_;wwBu5{oV+fLMr57l?r<_+tf(I>rt0i2KQtV!wU+_DE@ee}72{qw8=Ge2VrekHh((m8dC;yac0QM;ZTR;%GrGWi}$&nE;n6Zho9I#i~$S4!x zsvvi=Sn<~Z0>Xd2Veda>?q*see=&DJx`Wr9pB@=X?VIVdRi=k?Mu;tYlmaLHVSEQ; zHKJs8$XykPsqkCU{!3@5NTCkjDuIOvrj~VmFNta49ZpFDwd1X*vJdLUDorE`Tb7#E z(h)gGsMd7BMSVAQ?Pzm-l?UC+EH05gMv)+g!?lv0-o}O4$$;)_zz#tJ6NJneO;#|k zcV|I|Vw5k9DheyOY33$9Mh_`_20)v=C3&+19$1cH^-^67btEHpCk9sJ-lXw_$W%O3XhRC$M_ZTzqZTW1rMQrh;#tCrYJsL`$&n$ zV4xJnZ7Q*9ES8HLx@R$8Wikv7DY?15J5Q3iSH+tqInTZtJxF(@Hj)Vf_SH$wzPQkY zM_dg*Fh*Yy2&9J(r@+O%%eHY z{fdsKWLh=Vfau|*|J=&_@HZh0A!rggMZJi1)D#fHxR<{&l99~e@sAxG$|s7wMSWi| z9tkE~EN9v75A&HX>u6%YcL(y_KQ@JhI03PIKF~5#=u9;Mdjb&2 zi+Mx%rZ4$^ZUMO@uKuwxgo8W0o;-TlSj@aXgMlE)8II+=K4)&q%8tUqjR+KA=I5W9 zoP34=2Vjq{H-B;zJPl~NXbfnLh%9|aPtW^(?vMCCT;2vigC~KJ7yJ+G-D9s~ zHhJvs>WP?|3OInj0&IYB>cw6c5LEa5nqr}8Wb>!asOlgcr%h2)cJ3`M$J}5NfeJ!4 z!v7|;#uMad=D5uRtAbso<_Ni)t^R&<7%=$2rJF&L^7A#@#+%ALHXB)iF0SDJly{zC zO{H7kcg9g%ac%cTYalgN&8m;+>7;sRAQzKcsL! z9pdSp-)^vD46y^}ZSo8jw7~|G+H&sxaLztL2KDbbZ0?mi)ClgWC9UwIH- z17CgkS`JW8#g)EVwxU^5+l4f*{DI-wYZ4s7KrOL2cH>;^Xnc(=#Kr}~2eBT{{rL|d z+T{I0lC7_u7L1*@nrq^;#*J{QMywSe;GdeohQ!z2&9Usb4zV2je%+=8FuN-Wo4osyaw zOG%I|3KuP~O(nBoAZKvJ6A99jOgB+t0cj4+Lo|*^>p>a>K0)hdeQ;2Wa;}St#?YC# zjqH^IvcbLR39D`;M=8&11eM|>vtMMy>F8U)yuzWf&YxuZ`#?v2-hm>X!;}?Q@tB8` z!fOmsT#}Re+TGXCMhEnH$C*(=;_j?TzK#I@Ha!F&iI-)cfvO?E8!?-H!PX~Qs5H>v`6bfxFdo14N~kp_>vNA47z9PSn7%X5y^mcq};(@5$Yu`t-EWoV}Nke?`&98vC<*d=66R>Ot`8# z&|CP-8zazRrzcgs{y+q9pK1zgX=wp%_ij|<3-f&wm;7*oWDp6(W09gQ^?%W3)zQ`@ zzb#zM(6}c2hLvGwM~6Y$Vc`5p7&xHw=!*Y~s(2_abuNrPxCD|&3ZLl?0n1h_W93W6 zFEtnb*4Fnm5r3wf;R3RsCNFa5`GaNrx3MNj=_*sq%2s7biEbNm29*0`N+J z?>wQ`W|IhmA&~T7V>k%FP@5# zIm6X<<~=8J)gLm7G<$|s_klLm>pVM&mt!%X>V{ z8OkVf2)fqC1ux?`7>>0(P8yDl9eONSW-J802x>U_D7SKUVN8OdWk4J=8-pFp!QLzd zQ%7n6R@!8d(e^m}AW)q8#|XNO65@Hx-2Y3)5!FR3g(cfI~Sf_55# z2s+Q)#^7fO;5k~N$-(_(>659=$+0#FiLsZUhdqwx`I<~ zHJ^Q!4_~#&g-4JXVg8$PBEVpu$lIAT^{I`@OmXtS5TUWE%kBwo!4fhe^S4{{(awhkNpg=`Jfxt7In5W3@)d7Pu!C9DL?p53ulWm`KA<$hwy zq|f8_?1?44Zy54Vm(HE2uSTB_I+peknNFArf~kp+JZ9*00w|{PTT3>oo<;tUdKP;E zy3bp;%Lhlg%MoWZ%*s8ohb!q*bw_O%fZ<+mo_x_QS2Ig97-(r{b~x1dX;w(Ahb3P@ zhB;Alm@+MXF1aLp@Qm?jd?)fPdg$v)W)C_WnY`pBO^y}|gCZsZQvLGB&i0}7jVtQ4 zJF#^&B;?E?-DxY9y?KP`1a+kHKbQ(h?p5%cI-ETT&0w^qwUaaj4qjZ2f1|$t&3}D0 z=~Qp!^=;k*bN=5r0H|vh{?%{)sc*Hc?H`6{zFYe$%gej})i-mCY?U-p=O-g_;x;c1 z`5Tfk0{;XE5c;eAZ%apj{E;*OJV&qN{r!zUqns`1R*`?yMtRU__9FUccfm@=5%t>o z?GxnE^u3F+rkLTd{Cg(8CbL<;l{g`}i)|vBn-57K zgG0xIe}6tAb`OVR+#5H$A-{lbmRKc1&N^fc4GkH!=M5*buiqLGE^I;Tj{?kcbTdyxjot~Y4)i{T@hjy<+1ZtZ6PrYMk#S__K>z!*sk7$GKuvkx z?Djz=T;wW-XPZA})EM)jR{O|pP}9628^AQ~KT|3*P(rZ--w8P$(%*a3&ZNbbSHVA= zSSGuu62hoS|SV#5o~d8Ie%3Kn`pAEv$wGmycK$6 ze2tBqH2Gep-~V1)3x<$uYp13^YwHA1TXQJD*?-6^4+O%+rmG?xOed7*-k1l0A%y=; zo+&mm`J)$+vXlK+AJ>@J-q3;xcxli~dtfOboSmlY92GpecZHh?CF9sl(lAfhRNWWM zS%{$~_s|hk3?4am*~o(9T@QU=P`KarDm_!i*_LDL%FD<{HfKPzgzMUSJ74=1`@zxV z$zvx=tug__=U0JRc+R9+5pkQ|S1`rD&hp@UF6ZZePd%IOY?4w>Go}>l*@NnwtOf?l zNfmKVC=2@BGUqJ4=s;c|>1}a3!>md^EtYnIogbdvoH@It#ZV)P(E0qw*=GJP)G$AF zNo#UDhNK1p>`?3tho8JH$#>;i7FThZyp{;Wn8=TSgW-^4?RQ#+;u0n4ORbwuGN?V& zW*`w|wo(VHzF8mtAtkMN&W-w^n(tU5k-g#!ov#Xj2@Cn>({ds{Y)Z@PWUO1W*0RWrMHS< znBh&n?wo%r=RcECC0y5m1D&HcJ|^j#>#_g;G++H4`2p&|1&=PJPlJSdw(L1z3E~^1 zeF2=%`h77B`~ZyTCXt=x*T*ByS<{=XHUM5n7UgQL)Z)5`>Yjm-b_L13+3FNOZ{DL` zN~Q*m$Ayp(+}AlOWUh8LBO~K{aslYufSv+iH+}-SC^;|1)(1xG0n+WW|Ji(Gz9$%e zKS#nT0^CdknSN%p)XG8T=afjZ8w<3PWlG=~KQOWyC_OpwKK>PIY5DNrYbq-WF88}D z=%5>{>1wlm&Gt2LAjGU0B^}<~|2DW|_Mct+|NU>}{s0=fkxOzeVt898QykPk8WzyC zN)(a`?^2$3WL45|84$tLP3Fx&)eG4o=bgqD%<~KP!{u4iFP#)~J`LgE7=y)&f*=9#d);a7Q8)-D$BoJ^VS zw)A8ajO299nwOo#LNTv>@nxfy+|-&&Y|Juq+c=H=RaWNdxL^ExT-==3J-$u%NR<0|q1J2|-=;+~ zZvV89e1rUh!wxsG3>03jkj!n}M;a9p+h!V#*OkUI-{2e1C3qKF))`H`pwXSmRZI8m zN!63M$~>)KK?NJ27VWY*W zQ)DezvXGXox+lf_XG3Y=;j-Q;AX9Fpc3lBjt^GyOe9CK!=1*F6+I%S)mnNLzBgdiW z5wRFv3J(0jCurDdnG4<#Se5veK#DPYDG#lEbGMmv-sbX81BaIQ6tv<-UF~T@P{n4x zdqIkQA zOodNJUK(13$SPhA9L3h7bd3rL{ z1}>QfUr6?f$HV>3vIIu>u_zfUYk3sixQ{=dyjyP)*-<>Rl-WpN;Dk@-#=pbd%1u;3 zI}77;buE^c4VC9g#%G%EG`Ky6xkT|SFxAOSJyz1}vVNK+j@;#k@1UGcsw;Np7(&b#e*M}=eAT-#<-voHLR(k94qFB!M`88NHLy&+9NzwOjvB}Dc^j3w*(SZ! z$>r%KIZ-I3PZ}Bm!Q#}d$##p4_|J~8xGT$(l(aiTeGJQ`=l@vfn_jb#F&cHx#281d zTV%aw&vzZvj?=#Pz9;X6=dy%dptg@S3bVx_!D5ioU43vZt5prXDPW-JTi^nY1 zduhn)cB})E7hrmc9eMY`%JodPjoov$CC*+P+7*}y&>@`DE7s{&`FQyYe25|qj*sh9 z`FJE?gKs#H-I-fS?fs&SLeXwLh5ls;$cD%L*3U**Whf>~YD1+`W=9V*;xM(IzwO*e z5MUNS69f8NQ{#1e#Q3Xh6%5qWu9#MPj#Ad)f=maFvUlyYhEMJz?Iq`e5U>r05PT={ zY;$ziZ&6YieT26!PTJ8DTg}E9DJf`ZDi)aZ|ImzJ-&8H8OCe&{N{F(&_|`l68AV9K z`~xF-A~F}$=&>=4Ma;DphRLhaC{9z&_a8s{jIhivFePR;dFWJ_8IM9Zz|%DwRQ82> zCe+sOMnYGIms+(lz9Zl|Sa;r}br;K=ZJ0JD-|iR3+2yX$xlGI`GTSN8mrKM~RL|3X zG_wFXTFzjlE>t6VXMfQK`6U;3x__y~qE~{gTXQ!hR#rM?njmwN_Z2jIP4C2BjheDf zalH&D&klP1KAXgJF~~+CJg&m&o}=_;*qPijdrEQ7hcGCywgBAV$TK6Sw>h7P=gNk% z#D$2sT8pYK`jcq*lw`tuvb?1HFJMKX*X<@bK2UUBR@ee3AC=bTM_FA2tCz0^D~h8n zsy7B*rI`Q5Y|MjxWxFU%rvEqlmp#5&#T3nOLuCGlU_i;MYLE!O`|@%;cLx>55t=*F z+@g(5+4YKAzx8%8V?-)@s_?{a?dL(3TLtE+C1+^cG50=E0P$`2?F%HXIh1-29v^_q zj9;xJ(r~x;A_M8}__gSs*rOSlQn#wL2)l6EuZJJqaCQs}m^$LnQyPn6@6YLprz!j< za9!FrVMslV2|VmfHJ*7mA}bAvQj!Ffw$~> z+aXTVb@q9_-aO<6ux|$DeWb~l;!U;xqWp%Qmg{M48sE^Bb!>@J1j0( znVzA#l=qu0x16mf!IOJL2%$BYL0u9h^BQ-RcTXNbY{Pokw}^jmrd{%i+D;ioXf6as zeF*`8h>S;x7i0qNZ0&Y*sA!Z2-$70HnrdRKelU?9)CqTQaP-o)kaPj?`n$1??|{_* zOkn+g^jmK&{duW1DX6-u<$$m5@lp(vzdVKw=p6S*o}D;aAgjr-;;Zedm*W?oavRyS zkxd4}w%V0#mO$C&k|hZk>BpO`iZ^Preg+8VGqsXjpc#<!dv!hWLF=PxZdsvP zxxdjp(oJ3Btv>~>HJNW8_X1;AW_8enh_2;GL)Qg_}dl$aoik?y6oCZzkgwBS*tGN zWq+e*&En@~`5T(W>VhE4hw~R=61r!`UueU#prxGCMG;es6dM89yOkjb&yJZH7VozX zVLHwAe~4XeGZPTi^}Wh17IOhOGCjMjKw)u&4C%B{QR?7qyNcjq6a!|;a;*%xrrnoE z1R+Y;N?E#XR^d2E!kOh_OiW#%WJ2jY=zV-3Pk?Y)SxRfFw#Qd8OgD#7X&simU$O}k ztavikwkFOkJb}D(UL+LR{l9Tfa<9Xskn%CEpK<|yb z%cMqs@~)iOIKvItCbOF!ze=7RLYtlAbcCqF6C_>QTRWvKC+4o)xaId{{bn_ZG!=^P zQXiZ4>vslir3*HSg}h)<98;`<#-iudnoVrEV}&l}KBd$H)By4W%;gCtY2xILTO{(G z9V!@4%}`SUgPL-~&e%&+$%f&=yG0(qIrl{3NbXKur)g?Kp-3=zf>Z9a=H_d(DS zW{09il11yfqvVbxD5jM)p55zRGO=cs@-E$WRZAkyq?Qj)jt)IJ23P}UGJhzH4yw0n zFTkb~RtJjie>}l_V9)#iXa|Ts%no$j^;Rcysx-s_n7VHaF)|0PPY_l2Cx4I&vp#G{p!F-iaeM|p}i^0f+VJ;eAR^MA{7~hUf+n)w> zh%sR>=|pTNdh`MV6sAw#d=>!&pErXCTY{uBricm=D+SU5939lkdQBS;liLVrnqB$~ zzKbZf-|0#iTIkJ|ml#9Ku;9lgs3Jh!{H34?MzMCMmKb@AaslO7un~1lx=N72_QfSF-e(t>6VS4+W?n1q(M(FE1yW)@S&9g@Z(#V-pv60ZT`MAxOH1}X9w(ma~ltK zkz#Rj)1Mh_edt51gJ#ui4Qe}LO7xfO^nbb8e|5bktt7}8veHbS7PmFrPDwMYzg#oD z{Lwx7k}B9bM2~mY!bil`bjC!SAJR1_Dk+ZHH)|V*jx}sXbcqXgjzbeuA6Y9<>z#z+ z7MqccdbWm3uQA?w{w!jxr?2)TC@k+@Q$y0t3O?O=FdV#OyJ8_AAnBj9XV8gf_yQd@ z%R_=3DvPA=X_y+F`_&ig=$vy}g}w=g!@oUhZ<;9NF6$rY)g8RbvX5A=)2Uuc{bJ)| z3R4)pNbC2EX-CC2v$4V$QHj`DHBOdY4wP0&XB&K^m@Lrevl@k5ZUhYnzRMnI_(uU_ z@tD_)%qc|;D#R?BLMOi&*m64}_$~f?P?)!mPk2_=r-6aW%F3{tgnpmdy~IoCj9N^lB3VLA*FFw0(l*lnVV+3&PuyJ2b3Y6J5D3U-^fXYjp#seSEaJ3C4sJw-vVrNw4Te&sQ3yZO^Uu;)9 zAkoki_0WebPq)Mm zw+dv!g$ix$!6Ns)bY*BcT7ZM_{lF+b{i`78Eb8@*2I$7x&9J_L``(FQCsZ~pt=&-8 zG3lSxqc|&->?wL5IhbRcDU0iflJtJaQj!lH%($2=@U{waSqxXb4(*mqoC)0Kv$IT_ zH42b{pfk^m2oIPrpCCrr%~aU;QZ;NEUyZo=Q;d*}OY7w|xnBguX2i_6SF^j4cVcUC zv0Jt5!Qceh(W-p@r{;o=&uqS_n}>nW4lJtR_ALgm8xVgJ41(Ks+NeR zFZ%UML6MR>1F+!~eh~zeOWoDxRGOcFEhzbap?;!mA_I)N(-f*5Wa#spDGU z3Fh>CdOyuNEHay*mGr@ibE_<_HH|RnnIE%xeQVGbp`_E%d85PA&_le>1J6Q4qFrlO z!Jy`liFaRU{Z2CxW_RXVTxvObOq4^VXYFw!B#RgsBjQ~TIFn&jR?QX;zqz@Wl1F1YlWBeEWsWBJj=nNkCOvK(k4cYPWYD_ot+aYV;7X+7 zI7P6x_gGy+_g3`nI=j7Lw=`%1U8VKSmuoph_9!QjQ8bFKc-wOX<~lSTM5Q+9W4wZ7mwpdC{~$5n#h%3)AK*U6)o} zdv&9DlP<~!DQE7Cq`u!{4>sRzV+;O50eO70dc@yf?>A4@&M&v|J)0Wz{s=8dMZ5Sli6wZCTqbg1 z?BgTW7>b_5IMlM(w#gCOTmjKko*bhE9Ko4htrr(dK@$AH!&{6=he+0th5;bg-KOZ98*t1i7d(5%nP=ag3FOAMZl+T8U$4nc->{a?L;C>flNRi zplitg`cJtJq_-!%{+56LU%uB5P9$3L+j40a9^aH9M%4`By43^kv@=3>r~GEIdz;(n zz;r8t0AeUIenpCf&ek_ zno^0AIi3)fg&{*e~y@EJqFwi!ipU__DEJ#qQ-16{S z|DA|a*G?q5O0iV7i(~(D6kl4E{cEYy_BBE@==cV8lj#gjFUXbf@>n=b zEJMbnZqy}v!6f+6%(8<2Y$UwDAFi~=Q&>wt8FfXri$1iOoABPdws zqp4Fuq@c@$;J8b5){re~y#^Ji-qxefjCD`a#-j2dMgkCus)7Z(^5Cq6TAati zYguGLr0DXY_ihR{LPF?m(?y&>3v5>+k&z4QeFnt0fC_ghUBafT%Md?QuNKo zai}G~GY-WHamRcpCBiEB4Trm4q!Nr~*^ zn{_>80{RM3`+JWeo5c%fb2krHP5;I@y)#h8>^)rSvV5H%^C7XhAmhoBj5M!dO?hl$ zBhL6Wfz5breR5*QV5vhDWmnw!$bGnYcIl3ZV_e{T-vLP3{=%$yj=& z!hNZ)8~fzwbtamRjIC`6b?s-EeiS)RguQhYmDf~jz_070-W;*v0~f)4uGx0kp^UC( zaV1p7ZL9Avn-3J>yfU*yk<412vaUdwZ9eQmInrKOwXeEw=uU<1nQMO#CX6;7sFxUt z)8iQE_Z#0y9AJzaDR?kku5*h$-zv*Ogs2TwOZ{9C6Ukjz7SmxEw^}zuoBQPlZl9PuT?ut@#>I4jtKjOCkMqHdziOPd>sSE(3jidh}P9 z&>ODr9aGYG!0lOlqs;yTgX-HLYii(20Dr>&;*%fYezh diff --git a/docs/images/mqc_fastqc_quality.png b/docs/images/mqc_fastqc_quality.png deleted file mode 100755 index a4b89bf56ab2ba88cab87841916eb680a816deae..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 55769 zcmeFZRal$t)-Fn+z*nS{Vx>rm6qiDAOL2F1cMtAuDNvx0;#Q!zyE_zjcbDMqmSlzR zn{)pEI@tSUUwdu2)&Y>bJb7fuJ?=5a1EER^lGqq;F_4guu%)HMRFIHRN0E?_z5hZ+ zJaJ}X&O!Wm=At4gf>b&}x`%l4+)`Lx7zwEYjQMDcig^FRNlM!V3F)=#)7P^V3xFpQ z(!7JTn6R3s!6EcTteK|QPPjx@DDOv5T2*CXB}Z%z@|SP-DsObzPh`FaVcdV&m0)j; zcZ>LN@}*RhsyUw6to^1IV&KrBgSL*D84<+V=b92tLUGmkCzrla{Dr!*h^X~IGAQjM zyD9lfz=>mTe@ql{QdCq_QdAt=(BA&2YBUsY=dfzD{{p(Xxaz)h;YCF8?Ul%1e}5}@ zO@0yZuh)nND%kn8|Na%lH#NLM=KqYOnC|MbCw}whr}=*yP7H-Y`-r9qwQ2rq9Dz|0 zBdN65Kl4A$DgS>m=QkV7|7=EzGh^Yu&HaDh$NCi3wnS$c$@$FVUp#HFss7?l0LJ~{ z!`SL7tNPPP=8^Kq8)3(i@(qbit!IaRj$Duu3h(VXaI4Sdu3~_@H&ak|A1shtFJP;$ z&Ff|ziaT$FS{aiU@Te#m;Cp!+I*IbJ@XxAqIeeeH<$>FQ&-YdyTH@a_&X?%>7*prF zp2!e%;=M(CLssc(k6U1h(+Z6N7fk4b1$pU zx+k}@k}uu*?&UWT+g}Y#gV?3_XQkIe!hs%Suq9Q))|Tlh`Wr-J#)v6)bNt9IQZ-?zd%Hw*=ZrCzD^f-D3r^0KBi$+ip$`A6Mk<3rtrZFNxAf zKk90T99Gb#t7ndaGJ(*jcpaOR-2zFV|0MH`0H4>cX|8kH-A>yB@PzO5QPgAAeG<9~ z(7IdVikhJ^RFhx&6*~Cd*30U>;FKs>ES%nYuI$%8RM=1({ChUX}X7!Wu zAA=&In$O5ezi+pM8LtJ8`oW`oa28+E!&*f>9{W97;k4XXkIS^H4+UAGvZx7D{UOIK zH$}ZEkpj2NC%)GxA>My-R{)`xdTyO1fcg{J)!T^@lJhkw=vrQzj&$^Qa(I7Cu2xl- zg5af(2k=sEQGeBmBNF1c9B_MFCIG7eR|`T^)>Jws({-d$>S9rNoIs$o1qKW1U(s7gPai5(qrX(&Um zwy;AI@AZ}{%d9#&PBP>zwc8=%jgWWGH2jQp`DWYPw4k^T`^Nvelzg_m4tOygvshAx zSic)*_56B2$iwR{sdtKA-$NW8Cffewvz4#abf1JwCg*y2X*Lu~6edkmydt&um&!Yh;0Fgz!I z8S zXW#cIlDgIR7Kgd*mV>IL1+VdR*KujmVe6Bnrwi2`nyj5h(N`umHB#h26X zt}BBFa)TAfq5C^R?mPC5nk4!GljuO$+PG#|*B4a_2>^!?m-qb{I`I10^!40&Ah?Xo z5pt;rAZdrM_}>Q86li@(J8)D#f?(9Br`@U}FA1>Jx%%}~}bmH|q8K|Y!jaNAu?dYM~6 zRZJc^eBV;Y!Mnx?kn&2<<#2q|Pp)+P>ZBPmqA2KkX?Et2s&9LqBzZimIWVsmGYatA zRXt~RY=fjB;A5x~rSrZ2e#S!_7>vCGqC{9lj*|V8LTb}g!H@mpp{+Rn_v>x&(6H+J z7}nKf@B4Ld%Z-a7|M0=og<;D>XSx@Y&lV$4Ekin}o2SXK^<>^M{r+%K-I&?XE$nJSn(xJK4qrH|bnqfPU>4jm=e=x!oc#?Jke&g(g- zUucQtw<$SVY?d~P}!t-c2Lo8mx6d`@70 zvP5TBSUX%%C7-WOwciMN4WbKqP5B%ow3f{Z-jx6kgNKYV|^tpbL^<*qZ-A^30n?FBY*Hn_q~jp%0Mg-<>UCF!!;rL{!Y{b z*3Cv>f1?;licgf`G`bG-zLl-3R|wc#Q538g0z$S#C86oCbHSjNy?ANChiOIVH2rMI zG5nGlT3Axtm$CYA3AoOV^jpuMy|ROZ?T(T^1UI_*!$t2I@DM>^@!2%tQ*2Px;zGGh z02fo5-BK-N3cz|cST76mXYkO_egPK}#MwY7cUixalk{5k7n=LGIBj3hTJKhyeXzl~ zGo3fkBcT7$3Q6oSx65M@pbZ+YC;(b=HY>1%!!mZp6Fqznq0rpI#0pXZU|dVnIlk9-%u>~`h}VhYjz zmPod{6t5ndj-zKD=!WOo(!>9dq!*2ld8_8dca!LG1x9m|yPCUXkoxbbV)V`B^QlP* z2QLUMxOI2m3%(x6c>7K);Oa-%C(!K#N~N9Ef%3qRq9J)~x4KpV>itdW?%7A43LDIa z8X^^jrZk!ojDyDSMXww70zLApJntoe%=xcBD#D>RDy64nfaU_M6Z)d7V4v3O7+UfM zI23&xL2-PqOi$oj<6nQBorePGYWBHH+x}3PF;m>1({p~`Te}(*tYP8JcKw|ZaIa3W z5|KeaW+a1}*~V9jOh9(L$~YKYYcNd}*`l$FOU6yA(HR-(cSZ&9*~&v1R}oErionDF zkmE|SIb~(H=VJ$DZ4b&-CQ)fO@a_a4)*zSnmv493+6k&S(%z0p_QJ>psX^O_V9lhrb>BAr9 z#!w93wGILaXkvaRP39@H;n)|GB8ih{1e-l>kB{FBn1qGHL%+#NzbvY3$Xf&5Ir5z2 zPG9!I*3-qPiSN%$8O#PHBV)1VD}P1)O~7Dhj2?72@pBcduzphsN8H)`k=p3Wh%;_$ zOeXLMp7o@Qaw@rwstN}`?{)X08s5C`DQlRw*eDrX7{@P}7d8#NUz6uvKJSkcQF?Ne z6pViyWiT|=e=Doa?LjcWpUG)555Bnx)chgcgWJ97&2EQZf!xal z)p2nI02nbGF^RF>u>$hlk&33=WQ-^JoI>Si0u8 zV07Zbz#>r^qAXD{lBu!00RKml^p=Cv64=~UMF`M+kogAK za9tvbFb_5Czmu~*!Wcf7X4}nlOhFn>z@2UYs5e8zXiDYQ=Ox))S3>&zy2o(u2h5!JvYvSsLq$lAJ%%c;J%Lb@e5mEkCW z?eZ|Dux0i&Si?wGLD+e^#G`KKbCx{u6gsr?6jUM?pE*3wAGiPuHc1MIvY4|WVosn|)%172v_ zuJ9qyLTdW=-$|n#8!G@V$$7Z3oifYzxs!m`vv;S}RV*&e|L#YrvkJalcR(jP&|ivp zdX?VXKmoSP&tSH<4&P*Xc=vJz77}8-1B8!d0cW#BxWLd8o=iJfUfU`0+(QVsx$4{8 zM%dD+!cq1`U^-K(q~!|)T~eLAZia5FB+I+)`mCM=ATeKEa>FyeeU0P0N(2$?H5_a% z1c?1K;t}s!d86fx%Dsml&FIN>)%>u!tJSay-_BD*KV3b8rOY0MRDF}8&W3rMO8Cvd zq4No{`UQOiAyeW&=;8TZg&{D6<%2^Z z!|qE6iY8+BPguq9y#O>n~H+h-giBAsF%%~f&;2z zHSJ9+elB|j$&@GebI=dtreMMQ&ghri{%!G?7SS%=%2G0KqHH#RkD(za3ny=Hi$(=p zLGvS3B|d!WGOoC}J8#If=~Y0uQMxBB0Dao47Ri8W79ysyRyY66Fcmx+Tm-DB zhy25cx=95+#qc?ToUlOnSSf2{HM2o=*VzYQSjU+-RrVoQq-g{FF4Zg zE~D2d*8doXY~?Q)$%+d%R^R5T*Ja|j(efj$qMbfNU$|`D4f(?#^kdi{t)k*vJRUdL zlxcwb4m#}66CTp`2n9CPSQhv#x;!Mn5l~6yO6GGaT9+UCvj-#Cg^PfUgy(9?6bFXL zpNb`ZMW&HB#=RloUUl{4T*WAYN0#{>9S=giO>#Fy+5dV^K*r~FnE~_`y9;cG`R|Z< zoOm=C`0i!|j9q)!?A~%82Uz7BM!4{L-9s2&lDz;lp6G%f*Hh2|EjuF*ZTdWkb~fij z6_P^E5528|&KH1y9o-vpP$5xCn_I}+iK{MC;6&BY+8Fs=m!-n;b%SD?b{UHjMD=vl z=|HehRp36=l!l{Nb=j)%E)c-p>$yu+7f<0NCv?~F0Cqtaf)`7bVV&u>BhZse9N&i(A3$x{)K4e9C)`q;|M{`52%Ol-Fg#F@RhIVC{{nI!7gqddBASWD!btp-(BBw zy3b`l5s_nR2<)6q^Y+vd*eWbZ{zSIO{;S}l*pU8|lJn$|PvBuKUqx7+=-R09e`&ej zfx{|HP3Z%AGj5jsR!`dCO19@yQ~>yvW;*!(X7#4zWHpB}1(BEfJf?t!{10!5-z-JJ zQX-eGqE>l9_7%!}cZXT{YORv&H@6?!P^VBI%uu6V6=U2bfK z-nUhXzIRgAtSRD^1sRqBr@J>`*yP8cp7G0o-9a4q`1%ZFqkHR25(W(nc!>F8Rev?+ z2p#E#0X>$-*t{U__3WWm|LRC(^ku5R)_I#q+`)twhDXu$zH2tK)}SV;F#zE0@2 zg?0JR?v@D90Hrb{11&%10Dztc$r&o2>~^QX>Hg!vk;( z#!o$oW+d2aJ3E!HTRLmi#ku04&fiTkl>~TQ=DSMO6nU&V@0^f&T|`G#xX*^A`Jd~q zJ}%Ne)$q(Ccl0IwAN0|Wt_{zb<)PfG{R#-xbxpIXTB^TSg|zin6u zSh5q{v1O+fzBxjo@#?QW1SARF$04v2_)CFv*=aWK_yOuc#x(QJ=Ett;&FUqs;sfxq zCIB|&O^N=5HrZJJV02Sr(xjsQLk19jeTIiI@V|PQ~{$B-zwT*x3pGviT$60%8 zCF!>divF-$D){m87X$&aRcy6G_WdbycC+L(o9?%>1B5-W24q|AHU&J)RiTV0+o^D# zT@WW6EHpXfOd)pp&5q{s?`;3C`S)0Y*FJT?+vbC9;6s04-B?QK(}F_(bAgv9`a9z3 z6M28iWc~@r|2+7AU-9?vZT>GSHUD2*%^6Xwe{?i5`rX!MSZEWDhZAtQj+cwo7%6a? zSLc=zv`#AoZy(3i_dRGaga;nDKI!IPS|BN(j!XSr`)E`qYOKB0Wf*X2oba7V#{I5) zk=%1laIo%)G5j-l9>dPfyf>2it=GmbYZG{h1;(^o*K*Rh-V5gQHTu_th|#qnsfD#z z@N=S0eaEKKL8ivW8}}v!0nvu1qUJx#E)FXw=}JTjohk=?^dIb7E2n>IU)7z^yXKN5>F_agCUG}=!;#J&CZeBX*c`T6-#zh=YC zndemokzv74zo3(!G~OKC6xP?%!8h!~ZNg_vh8nM8JRn4`F)hCQXDep(R~_D}48xI{ zy4B6+;dRhGlsf5MLde2Kp_-kt&0xj4>3R zhquhEz2pj?@1^q#2>W9fj)Lo|e>Qu;f1NoyY^u>Q{MwRUOwH>_4=8z=h;cgr9=^=* z?xGoVzo&BQKig6XySlGE%#IRELH|3M`R8%$1||7_>z7ob{BH;Pi(>l!kOxD5aw~vz80WD^z{{}CSKKBaMsdz*X zg6)>mlPEl1p-B3iKpQu{PzB-uPdhWO{u5Cs7TY70bf2c^q^bito#+l%nrww;wH*q9 z9^AY$9%^s&xgT$p@9X{}TC>IZXEuYUIBot@Zd+L=dt8Ib>xM9s`UCq}w*sdfH-c>$0J>4`lZ*J!KJWf!Y{KJ18 zO*eu+eRMMb1qB7s`&Lme!UCS%p^vnj9Q2HvZ-t@@!T%j}87W(a>}+UdXigJcB$4Fw!o$e+tk>*3^i~SJOF4C(3^hQo`+k zUHc7b-*l>D~O}$@DWtwNsB+WB=I-1wY3B z)aL(26^f6bcMLQ!gU#$v8OoT`dO;}%ZkQ@+oL)F*{Gtk~zA0_h*@O(Wo!zyFkK)04I`B2uMsXC_I zU!z7c!RhYhJk8D~`gE!0=iP>pQ1&?a zB!)_?vR+2ekCH#{3X(;%F)T=$KuNw;e-z^P__rCKy7~zHo4Nd6PA>hsiCK;Rkg$~!x* z1oZ}mhF_&o*#{n_Gl6O4`E5MaZ`8*?L(y-2KH65;x&P}1M}c~Nt(r)Z&EUbuGWgb` zq7h*-WJ2sQ%Gao%mg#yU&%gCFZGLyHw3wSiqxS1=ra7 zhfVM<(E_q=xL(ERoMH|F6v6KtK8Lk~#`=qi2h8)gZN zpyUxJ+PA&F!GFW~&t>#~6y)_7(HpW8GA#0Jj)JnO8cp|o$d$>=w7`eLBf~3W4w@?I z3W{(h>8dd`6ru&FGa6{(H&J8WF#<6i9@Pa!~XE?j?N_|er(s~ zoQnPL+2qvYPfp!VWX_=|XJ`LT_K`)B)Hpg6`5Jj1h*XuWGaakV^^5GAL8 z1<+W`_)7+Y9;rgWz7UMAb3^H0$qF~P}9YX$|(l68N)eOTs+-Qe#c_pox#H>9Hd=PVCb?037 zc_zYv+uwJQsXssy&e|r6osX(3gtZO%F+;}1ED_{DN(OKVGEW(OEgOHy`z;Y7edqUg zys_WA|GWh3p==edvj;U(>@0s)K za$RXeodzH`gT9(d)4eY`^}kKtGx+twpn!(!VK&>E+`yXpuh(v|Wpi(xTH=d7h;v5M zR!OVLI0!YPL@|EdV)~92GWb13R$pt`GEOT?Qb3x8FL#*Qs?^3PjDp30bwiH;|K&TnmI{XS_VTuIA^Xnk) zsnw>~BEwGBj$xwjGp_8r=GxpTbLY>4v$JC!E~~?Hz8N?^Ndu^6cq%-o7f>+JKkXTPIu#nTp1%Bf8oJEn+~#k zN$lGfo=h(}gTm<=NmRx#HWubhurWa9!z_j0mirhQKozcX)o-MCKS+U+)JmbYr=O&@ zqxm_+j`#c2m5$2FzBZCB1j*|si#Xvy3^!Fg04#vUxMh?he_JB87X1Pu^@Js}Al%lvRC}tTS?07wM`*eC|2fyacbu0nu1^PZ>k4AuS6p2pa8h}3!lXb z7r_gjW1#8@siJi4P7|_X)OLVfrXKQ1D=O4MjItz#=B=8o?40SD-1vq-P6EOgSr>U~Z9S?C>u(HvJCbLw4qC ztop8mY8GXcZ~_~n((s%NJy11JVUEbad`sQH;>i#eZ%GutbswFi`1%Pt)KH$zcr%DNDbV>DfG#DbOi8HOuFJpN&gT2;Iw>eOv}O#o z4R?4w{O&%K5Vb8@eB}{yeS>?T6RABQWkJM`{;QZIfGnGhyGq@IV*-6knvpw|-p9>L z8_Al3s`00QS`2aOB3S!KJ6PoClJHk*^e<9Ad|2h$i@?&-W7MU;?%kal^yz-r<+G^1 z3ePEaFu4kt4B8S>_b4Tog*3~bz8YIp2aKD9eM`&~kMoKBWiRy9>3*ex{3JikcJ}Fb z%F|>X-1Il#2ykyN?PknmKS5VQ>R)oG6|@i!HKt@e_*{`e6InENts%!y^}F{k;`8W< zOrqN3znhy>Y9D=`Y^b~%VAL%YTfa)04G_FL@T75=u?EDHHkKYcahGyN8oqe$#fkN- zL8ZX;gEHG~1>0NUj1-Y$rY3Fo=O%*5W=W@_?&iwRXu`HWXo{>Xyp@Hhxe!iZ?z&aD z4#nffwZ_Qzzrns#X;7I)Zjo{zoMhLa+xqy$Lg_DE<4d}V4`)a2&!Cd8UrIb`$7hQ~ z=rk3pL_>uShe-#nDQLLow4nimpL(^LXX95){J{Vs+#}lAx7hhMZKMAmM z@F@}Uj3|<`r$;{V-DHE@vA-qpGrh)EZ5nLHWL(KsXXqLi6M2tSeldQ*-*^A#+2(TN zh$e0D&p8p<0o2}CZ?Hhg*9_EEM8poNPOG1Aa2MN4ah2O+F;TTtw>uGr!H)Gh>J2rH zXFLlZh85r9yE4=+UxGnHePi3;6^A7(&UUa7E_@yVU?4Y_-Fl<@d%Quv-C`T%DQ|3``&(L^MPUn-q&sCZ zIsW1CvgOQcUB>3?@6N76^$4n~f@AH|@$r9Ikk}0E6n$%+>4bIhw}NC?o0k^zHGQCq zxp%a2gBW2V&eD+hK-KcNgv_rD{9j9$3M3nTudV&qOyVhqdTQ*bNTlgAZR#YREPi=I zfkqQU1+uZ!r~ zapTZw$fVK7r9vJg-B@Ml62+w5DO-4xdbOHw%~CT+&0R2hKK6+*aN;}#xCcXC8`-rj z#;6lm-Bt>#;*zI)V_WakvCNkFRBe|M;i6nIt8_Sqf)GD$y4Ebet;_EQ-h36+-}Hwi z*G}Fgdp~G<3==(#xp-|EIBy&Mupf-xtXVY1eM0f9a^eqffibJ*| zFeh(6S1byR5ldEw}h82UX3!s5W0g3eUd%q+f2x+?Q9?AJ$OF(NzRM^O0ul)+F&srRw4rpP9NNM zC+6g5Exi}AgJU;t`_6WH(mrCoZ3b*c%ri})d9Ihd2^NoS7gwNk za5jd{cQ*6X&O$wBl|Mpu%G zfG|V3AiCEMp;(0hIdu;xI$DRF-Q+5CzoEklgGPL8%wa`qXo-C(ae{e2;oprIn(;Y@Rg$=FML#BVB8#k+Rsl+tItuyeq~L*%@f2v&d2@{8TD zM4U=vKs?;y0D1T4AlMAjt@pZ4y~b5b@2%c%N=e{S-}#nshr*)&pdIT`hWpYx&!zQe zjQd!}?*!y1TmKrsOhSFkV0&vQpSUeJ3^??Yn_vhJE!C@OqdrT8p(8U?oK zh4%j8J@{vmM&n5g*a{t_Z9=H#&%@^O?8k?dY_{BgDp+AGs7eel>=}gdqYj%0RVi$( zsT+LAc6Q%axVf$PzQhzC+57B3hfK@;tUU~41cfVo{!Kj}NUffe)J3ZeQ!*z(w z>Yf&dPaI1$fq6}(4-q#NuR(Tjuk+8QT?>!Z%}?WO-j#B?w@`gzPQ`$y$X_?XzFGTR zq4hP-)!S%(Z9A9kK-iSIk7=8q-+i=TuFWi-ym*_>eUoPt=U@$W&Du0xolIbxFcuds z4|Sb9PnETL$71WkID^fx}bZ->Qs>AzZ!# z)c%0bGRnt2(({R^w`7S zQ7`JPVihS~JElzLcg&Jdd}{iZFO;O*+4PfZg117qLHd0iCL@#g)Gf`g%DXKUr@=Yy zaQwqceMb;fi5;K|T|B z`ANT$P7xM#`E`EtzTje-z>i*~rOcq&w0y=+5+UNB=7_ZR+xavh$!gMiy9+D2V)I5) zXmTO4S339dDqho((|)vpY7L~`^o1fNL?K(C>SAW7+0tP}5O6WnD~RdrArPuwYBrFn z0t9YDTYbmUanM0m#&K`|H1tT-76<{b^1V|*ZWLDqsJ;U0k+kIi?txp3rqAApczcKB zo-dSweIHV#%4W#2=aTn${B1Sv+UK<<0kN}qKR$ZB4bCuBx0k6_9x~vVoKV+ z&(}WQ=Jfd5nXXxN3SCvQlpXd}JoI-|b2eC!WgJd}PGeu$0!A_7d^#zIInYxi2_?*Ae@&^G z$PDnH`PPs*7BM*M79tWQTA8;<+CjnjahNS z)TAw}dr@;mwFV9luiSC7%1XKG3xtoE5sB2~ygqfPHmK?D`3S&-UbuAZDCpu%&f(5$ zZ=tm6>C+h!4NRlD7~_9!xK|Rw7kh7$EdN8&O|Q*;*ZCaD z4jJd=S~Xv{DiBm!zi9n!b0}i$`%OoeZgb9z_M07f<{%w$=I`(F7_&6GM`$zITB8MB8N6Ln8`vU|&v^H% zzlI7CK3Iehb#r8caRv?DU*F)1A3F@2*T^{A{zQd`>S=|uUQsZ&KA$%6(}JuU$Osz{88r^rp+Wi2e{`0T9QV1?p4 za~L#5T~1-Vhe|5^Tiu~ICc2J`73V*Tefm#B~4=bveHUwyMjMBL|;cX%8)=8 zoFo#i&)!T+)w-21=sR3;km9s1*flcnP%RDC*F=Tm+O94aEg_pD%leF8vta2*Az+P5 zADCIRacf?WQ5yN&B7R1q%5=w5DPM1NI*8FkNSjOkOD-biO1n=>Yb5tgEnr6RP3U8p z5Y3K}dS=;@c)-P$KCeSaK>{xIyvtA`@hFg}FUHmS*FTS48)2aw_y`Ge$ znPdOp^4YsOOpB;eHiXpO*`L}sIyT{J3b~>{{`Hm*>q&-6fwqLN*}Hm*SJZr0npYDr z?=PMOu;BO2GP-?w@jR;0&XjsqFWugHNL(Ya_7gUH7>j4_c5%P9E#H1=OZjV-#{l0u_)~I>-0fUVyiYkdf9XWUa zM1Xd3e6i;hJ1jx+30m4J7u2Est`0T%J8*(f$K%%KjgCZsHvMO3bvqCnPh3H|?xQma z4rSbdWu=z(`9a-Vy*y?Xf&ekh=h1@{dte9L4d-_~uQ60YMb*`Oc8Afv+%Yp?VF6=U zBVxaZSM8}7nHB{T5Ec5;B(df4+%q?_-G3OE5S=3EkUl8VV4L_ckv;LF(c9jrKJ0u# zcUAY~BU|YBk+VVlfiscRFj_~_Mj8R6yWmfL^BTYEytrmUr|}&luY{yq2gBhj`^c5Z z^S(cSkrU0?2?&(}>)0c{^rSVWrQMSY%$yc?UR!hrcSNmq+0&B!svJ0?5C~GA8}c>6 zj3N{*t4OCfKpu_^evK+tV7fprL3p;sL9(|iBI7Pia)v6MwpCc}&x=Mz?g403Xl<e;viOll%5G z0F13z2bFa2Hzg%Djq*8s(f={4DAR z_VYbC*mT3k8^YwXI%jshm2GBx>{5ieUdx1_gq9OvdT$5b@dmgLq=((RU{ZK6<-f+T zm}DK>i(S6*_7hf2xOTX|1-7HO4%Lop@E&^79{! z@9zg?%&B$Nbb{u$4&`iUl7ECne{W^Zt*<`qAxIkdiPu5@9OKNSobC�)v~C(0C)c zgd3@mu<_@wnt>uVJydQ~oz|jKOy0;^`Z?+o2D0^+hp!@j_=nH5zG^AYBuV|wimv<8 zJ-BGiO^XI}T+0%OK+mPa+&L+!)PYa5H}wL${$XzJBCc;XV=Co{g^!)F^tz?jpNo4b zH_VuCMYaCaZVyd48bC?#x#Q0K4CK%<=X&Zv)V@IQ!g5ZVK?zTp+C(vj*rq zre0*ZTR%sn9`4BUqa`iQwuwP$!iTu9y z*^Aa8nvPt{NV`}cy5l$vTGknczicBgdPa#+$B~_lxB0^l39bW-wL`u?WXo>LbCrxs zHO}TPn@o1wSYvVPGZi62B3}9ADk9<9rEQFD-?ViCJHyk~ulRlQ*z07+ zmqT0+dAd*&o$#ah@3U!@BqPvJ}Ns=MjBuIqf9PCEedGznEA@4tG^@#xdHP z5}hhW*p9vTm8p^F2zoA2iJy%YoUT99TiNM^!6xPDkXY%@^R6F7n4GGx+4V!RemOu` z=Bso5M|O}5LA6BSOdLB#UmR7s1}UL!yoSsl_4aP{66T2X(LM*|9)bk2fjUQG@;XV5 za7g2iD)Klhxr?NUp}g%l7S(du@pSRzjsod24a*3J?<_x#8}8QdV|kf7grum zMHRS^M;MRa{Q64RKHpz0W`#~YUyQ#oG(l?D10Z|E)=~C)c9e1bRQzl_KE8L*d#S4H zGq*7)2eRPeh6YhjH3bvBj1tQl|SyY`C6lvas01T(9PNZJK6 zP3wxPDqmT-KbA4>ntJkBD=r{uh>P2dKe_5iem*i@&Qi7(JIJESfjBKGU&VlMgWXOZ z+grrgAg-ko&vt-qp3qk_{Jyj{S5C8tp_aWI-lcFeqdCorB>t+{;r}X*a{YZ_D7jsx@3ZLF5~Y0 zEmA^FHl-=O@oYTk=b{3)f#6wrVMR^aAFkWt`K!X;*hkOEJ}h?qih1@jUzl5Auc6L~ zxmKdYX`}A(wIiw@Nvhre3EN-J<9T?KI85Pa#lXhN0pxf~!g)YyRJC$%aOPVO z1|N}Vm(EBijEx+5zwlamO7S~iGl_`D(3_AYNv=Tp-B zLfLb!LWW&-P|dCrm$Sp?uU4-Z9Z(L)Y`Z^8vKv;BwSQutkP{9P7Ks==4@J%CYWj*9 zM}5&B_xX$_jmo8fH#TZaygRjP#vD;JIFLu_3CL=zp!gk|koyVmeEXBMat*taN>zb& zg&Kq-YKy~J*#7QCz^h^O!Y`}mn!;bvx)sw2>M`%V$C^-PmWPOs%LdR>R9a zjk<;fPnjUHaeQF}hq2MN56#UAxS3c@3Q9#gOvfR69IJ)f)#IIsnP!H1MzFJ+M~v3H zm2atRwZuz(u=p#QW$W$iOXDKnfSyYt`5~>Wm|Mz|({I|E$#NdL=fer>#3u1y5dSj4 zhbTlcNm<$ZXDm5+&{w;^Vnmq)aShdk!HJ)q1*3!J?c7eue z4Ayl-cd=DH3Kr87G6hlUw+4yt%YStriba0x#%6h8yWB{-wpg`bEXk>vAuT`8CMCZ= z-ET)=GS~U_weHAuj!N8$QxriRCC_$2*OZ)z1s7+y0Y=tKL9QtIwdQO;E))*V`;X)q z!yVh(pIlUb7qE?K#Tiudee6%#>#9!n7viM7$pyuCMEsl%le^k_Q@40@a~s%d)S`(E zEoa4Rt!`>1A*l{oFdqaZ%8$Gp!HH!0fyIoqj-0fBJZJCd=cuTUbI%~>YWI-?Xf_iU z;p(r4yd|!ntJP(HtQYRCvJmF3CM-fcN?4UOu~xNlO#K4l9UutOL;i*TcD40HZNfNZ z48=KpV`9#O&p~l1lqXnxeu_{R(_Fy18x?Do2vyIpfsMNi==h3*DeaW9KFeGKVIEUk zFA=1Sbsa>aOw&?cN(-LAsQGLQI*QKv_J(QxZW9@`w79A$t3iTm_8RU}= zPk1~jn1_ubHVP*Y=ty%DSKZCk_LL+S4BZt3ps?hcWV7U@v&+g|tce!uuT zoaf$auXWTi2^OKA6T^5VDK+&=LRZ zh}nwN4f|Wi2H;M29qxDsS1;ds?$L2%vs&=*`}(}x?fu@t5*h?7mkz7o7{o ziz|$({9mgQP|Q^QNr%LsNmqXDY%h(Z4D5=5G#s8mXc;bGXjqNhviHGjue>Uo%4SRF z*bqwj7Nod}m)P&L4UmIEG5T06`^F6ydHyGsz7w|bSdf}FmmV{OAIoAn zvSLZ+%SiQOM*3+%Bp+W1Lg$l}=r{Uk#**4isDECH=%jX5K&c!$Byp5BG?w8J;=YkIeXoqkj znKUFjOl-m^nECRn!;La!Lg$gJIgh_m;Fm}zxFr*;hzA!C9k~v(P>w8rpF(hXh1ovr zzA%Rm`6u4?vDUSNLT~;c9KJVF;WP;$)M+Y!vNGWDe8gda@!UuX;bF}B<-Nf*2T4sj z3>#r!`)cWpK08bL@-hHE@LQROyQGIdK{mv!k;3mAV~Y*& zSx9%5c6=H`R2c<5TZom~S)T3I8*R!KE9Z zGy!Hum?_Ifj#-ah^FhR$lt)QpLd z4Z=r(dZzP@l^;2su|VZMmnmOEH~2N&6&pO_5y1FY{2%~AEy}vnB0qX?;I+BeKcB&f z|5-n=5l=bT!BIq+;RyxX6beD)7x>UAtobc61SA?P_ozwGiB-Aj_c@!Lx0)r0&$Q*; z7-Q3p>Q8fJ@t8ETi=ab%YjAt}qA~>G@Vs;N-`I%rADs}msjm0>eWY*01Gn@It7Gr) zvfk|JHY~V9eI(H5^?}anqY4?%?)Xku8F<& z>_)a|3WD-J7>6{IyHJ7Ny`sr%kPEeFA5=8sz8I;*LW|uf$ijVCB$3K8y`x{FJORg-`CT zC}*oRScJZ^5!az4e_~k*L8Kie5o|%0U=n+}6MSoXJV^q{avZhx_N7Rh6~0qzf$Y&r zdu6)*)REIY#^T(0%7wuvlqQEMvE;#rG+58^o-`ukh`jLP##HQy1~6-E4c@rB3Pqh8 zDUnBX7mjDFaBO-{#bn&eWY$}&K#}-hW>rwhHS7<%)64c=7yoZj1-pKq1+iGlPBJuV zKWWI?fcdcbKl5WJrm2fffh~(~uvkVjp*vVr(~|$L=|8=URvWRpUf6Lsh5vzbQvm?> zx`zl(i*xr!4lxhdG3~Y`Q1gGiOqdro9<4s_DQ8>s)cb318F(RE9jSx=U_oa)!&<@6 zW>xI-V$Y4~$-l&cpIC)?eD<+JdcA$LeW$*9XCE(FnjzJSg_7=*jN^W1@WeUBcjDH4 zDPL7o!srDPfz9aXRG;qPXHjo@CM^=WfXt`E4qzoma*pJ40+uSL4biBj23qPqe)@#A-O+O882J9sS zx^ICqC-ENXg873a)hiL?Yz@}dc-2eO3P(wUqi2Mlig-`}Xn^2<>c-!c)nYA2ANpSM zuX$`hTok?gLtX^Ds38~f)saMV)hGjY49J#-6JXcd)fmPuT>MU&!;gXb^H(>&Zpei{ zD6$?;nhRf>Cl)J|l?%H+@7`H_THjT#q2NZFv}4$jI?{y^AFw)t(<3NOQOC{@uK$`a zoPZm>!1K=HBz(h-CC8)qCeFF)q=Y?4W0+Y>aYM_;Ck3GXj6bx#QiT@aGiN1BTVkl{ z$_soMv^o*z|IS*ibD=5ke1x4mH+90p^=6jL+vCqdmy>bpw>AThce8)=@3y`C^n)S` z2As*5mQq-ZofZMgl3aFv4EY~!kc=DVgPk4%_|XB9(t z&pkSvEgC-Fd2cJ<#I~D^+)wy<2|Dc}KteTsyumg~<4T`RTwO73uT1x6b7?Nz2m-zv zqyOe#?uynui^nat&s)saS#K051fD3HM8_dfRsv_4@!qD$rGwLBE5@Z2j9$ta(Iy%Q zyI?(ek&`*!o}zI)2_mMe+s^6{Ncvh8eAY-1@6{vYFcn>k8*Sfm zy$cr$g*55TbyE3$Y-}MsJmS0A>(>=$`3LA|Pq1!y36T*z%Y;3sBPxQ9<3LzLbMRC2 z^lI6cc)`I^f-xhbbhyc!6GZwVIRv`9)wSdf+(mLG-yGJyMG40l%UHu-3#%X;qlpQ4 zI#_zNF=lp0{;4(>6BbnpqPK82Py0fT!H1JSM(`6+d>88_BgyPd;`e|gGv!)&v8f|h zKFe}=GlJEsk%FxPR7!jXRBNR>!wcL`rav1Gca&M6@ZFqE% z`4Mh^%VfTB>88(OnS}XjA%!~1TgzdO3p7|7|926;mpc4??7wq26+B<|^nJ2fDzywu zFo?l1EdtXHOpk5ff@z1DS-<$rG(ZFiXuFs|}Y34Kpxiz9w9v)SYh`Qlsa!LK_OFPk$W_-wQcU; zqnMAG5Q$Prs$WQkS8`znPLX==kuQ7CiAW{Rl1k9zUL&)gL2Ky%RI6%ljx`3Lym78HOG_r#NWZ`h;UmT; z8Q;NB(OjT-ypxw`C{7rz=Ah6?Ilf*d)0!r@p+-^-rj8xi z_6SQ&${Rp@207;QK;#<376gviKcGm_O;|y6$pBqF&Tj(sX+L)PBhju%zN5&)Py{q84S1 z!u8GCK6^gp(|xu;h?PPKnUh7Lmhp+RzfjWm!UtOhw9(KveIW^uIn_ z_4XfElclN`*ZUd3r=6|g_*_mCYn{^noi)emliSaY^fz<49-|%;zdlvkVbJWlK+ewK zY*{HA(P$@!lXVkSTpg#-w&~WQVm=nA@QV~tjbwOd-7zb2C?(IOw{6?D(sBB$ncUFf zOE(5xIKJ9Pt&il#NG9BsH`1^QjnQt{9LJsje&!xuc&TL(@ zAuXdsJ#S?ulhXa4ohB~W21ju2HEmn9;Ale><}Dj~ZAt1pw2jd+HpPP}W)J-w1RDseHl7A;l`H-f zBR?QsBau>#e*U!E>9Dp@ArRa{F&#eiGa?C9X0D*u+HD^SnppyBly#h5H*jF%%7=!sw59c9vD zehhfcSO<-^K!2XtS}}-6ld)lbeq<@ttMA$#^BVn6O>T$3LxpcObE-NtEn)SH3DAgsjf%Hy@L@o z>)9|}Njhf6u=~m;LtCH0meC4`1j`X@*Usz5Oj(WAi)jVKP9?vMg6!#`W_aJeyzA9E z8Et=&jhAK;rplBlx~kENNni)V)@4o#6iK~r3DI>TTeDky--t|0k4HK@%pgO9xQ%UD zyh!gX7B7xtM3{)5K!6}U%CGpooZ#bwfJBA8TNJ|w2h=#+HMy)2qAkKu)x~cv^MTR5 zgRFZprT~ARVEa$0VJl_teYh6S_m})2e(B2S7D%gA2}!UY_BEL%&Tpl&tiC2nrB;xd z>BKo49MIQG#xbHH@XVM6HDxXHxI_x8HLWh^aO2<0Q|I4KOH9SCksvdzy{{R;Q_qkt zt6QqxbuiwIc%>4LsbH_z77CuZ(N3Eh{Hjl*tq**sjUxsbL00hB%O`K$_t@x|s{n4T zNd=a$$ae5z7;Rcbu!eQO`0qOBG$j8>tyuBKRunfzdwqI*M)DkXw4BTY9#k;h5lpSc zQ`n|Bngm4zP!!TzK$%?Z-G;AmCHO7HG zJ4a(MJnx8jrjb>P`5nQ+l}d5)GCk*Icu;gi*^oOINvafMb|ZIakvKmN9Bc9!zuX@| z8c!6fcJBtgI}cj%Z*hu}cIGcMT*eEDaRt3viG8Pz`YPlFCsx%E3 ze|0qp+oBM@_a-zIsY9^~(nq26QCP#uvzBLITT-Fz1pxTVGcnL9>X6Hfuvh0pCi`ERa%Md2+UxG~gfM-;9Wc)ekf>K{tXe9Mtf!(RFbeqz0o?=Tkh6Nvrj3gQ`mk*o^N zm!-*o=#C|``9cYa3e9*JN%R@qkelPrEPd#e)szjS?u45l-g~tSiv;RefFk~@$ll69Yelw0B?`5LzC;tmCJSyx_+HqT%Gc-2 zhqa7V;q8X$f6QtH%hylOT@X$Mzo#h71A{SUK$?cZ-d!_6boCTtWx6T|zRb+Ik5lZx zC5dG%G$-g=G*YM6F_`aAlH>GIDIqE;_y7oJh498JT}+&LXR4d;+c`H(r3h&!=?z9x z4Q9TKSxmY$n+qmpaZ(L5^RA7HmY@KNAqINP#5>dVozR%cDNn*ch4az#C??EvxggEz zsSOE4zWxw3&F#htFngbgdsT{RM~3V7uK!%; zSN!T%2CcRzG~5cBOfItKldRJy+p^9QA@i?}dZ znE+cDmfM=j?ciR(FH$XL?toJf-0P#?``x(7+V%+5_T&Q}4ryu>>On>|O2>w&hEpt* z5)Q%Yc&uncx(~56ht=CiOPu^_jEY%zk8Kpx8pu5Vbwy1^yuRo6Z{#hTke{V6p)&Tv=g`ZHv@IDp| z9-YRIOoK7?Vhu_H48|kcl8_9){<@Y7i_RF`qbV6-7s>n$_Pk7Q+O8Ny@3HclM47Ac z6zq|t>*>*jzQ1Q3l^j2@k0ZK+I`N0qp{^YV!oBYzZE5 zSvR>;F(^9oMiSA@_%a>wFdl#lN12STlFn`{Qmaf}rDn#9RS6j!Q3~}X zj=UMxLXAIWT*~kt-mDJCc)Cpz=ibFBQnyK#3pFG)Am4l|0PbQn#eT`Vij|AEU5G%h z$?8@IdZ=eNwR^{eh9<;Pjkqg_&CZ`Hvor z^fGvd$l6WXOdtBDp6J#m__((+#YK7r9MVZZf^jwc^VldYv>MnCwxEHmjCA-@!jTj?aPs5l^liizJ(^&FE1FpZ{Ym2#`r~ z3$WnCaEA?+aPxO%`B{1|`gSd*Ka{eb%NZ?ZKVE^@Xr40xBKY^cL=YK*9#^7FK>)h( zQSI76fgkV{B@bpHxC!faVCy9_0+fD8)Zyl>Oz5wZTeI&x21V>$btPM->8wm90k^yf zdoyGD<+a&Jz#pF3h!1alyPUX(tHDr~S87UyD+l>$24NU?oQO9D4|DnM<<{P-5v z0EfE~)@KAjemmaKTCM0`k3tG8krF!R2_~LbrBR2%teCVPh=veVmQB9mWCw` zRBgo9P5Zjdo9INN96~`85TLimeAWEwn27-7gW?#U5e%o(cE$*1-b}L?*H}@0i!8#D z>Uo|PP&r6F`v|C&?si$#j^150fj%x~5ONvfry{1>s%V^z?BIVI6%;awoqIAAE+1r% zr%okZN!tCI+p9joS~>M{6SzZ;3?!2Dhs9X!)6EG?W`;1=K2r-_=(Wi~M!Bb|OgmT_ z`2VC)SopD@PttM9_!%^JN0ir>nt%q^UFnwBe^6%XTT+3YDSb?Ycreb%B%%D&Nya3+ z2w8xJsD7FRj?pAvgW`tTb`Y4^yWJDg1&-?3wn>%6BsC2_CNkshL&e|3s0g6 zCp}stZhun&7%~}K)l7`s*HIU=ZT@Ig^~ciyxVAo{|#log(TGcqhFz2n>YD}PfA{!SqL*%27i3L zVt~5xwo(|dpyWNbTT%Xq90l-OjX0{cQ19gm4a+43;MeNTZ=^*pQErF466HVSl3n+B>}KhjI4M{vNuAyFoXS1WABDQ=ro#C9LHsinW@c$u zat7*s0VfDf|5M;;M0)rQl0tU8yk)AY$&F5i9w5cuIvS^~N4`8Er&8j=LloSD zIB@a!n7j^ZL*-A|ES~z_uESM3XAG>{e-s_b5@Y`0H<8?2V(vtNLcG>P#L70QDc=)3S59YTUZanCyxMgJ9IkJd@Js*GAR@QbFvEkyRt*ihX00jFbI`A{T@Hi7a>$ z9dv>9Zj5Nb)QrZRk2L02K06WlI?fU!y<7-R6wIRSDQm0??g)lKHj%zN!@_9%(a0V@-q0Y8JIgQw0k zW7KL3JY)7Dk5n5?r)jU5j0mN7vF}HdGu<)aLXMCHNd@t)OBd>dOcSQhVqu3=2eTsJ zgNs889adQocnYQEJQ%-no23VQ4pIz4bPKzPwc4-DLBR#uam?%N00hJ1njr|mOjTE{ zuR*ca{PW6n35vM9iK!*t8#DOOToBZaHj4?8k)~387a3NBLhj#R<;uK?z!bpJAS{wMPPYv6QFvJ; z1pm(5kCd0#WeWoFpwEhy?MR{TpwFJvXUtWgmeSGOP~>%i;$uC8L4s7CRaGSMz)fV7 zUH@X6>SJwD$y@wy2ft<@D9oe0{#fa=1O4+V;?Bu0XBj9@M&lTPmY1jKr%$u)t-%0H z3-xW%={G`|GW$M+@#1R2?cK`Es+e7a%3W&Y1={ajI{pp38a*BZf*cLMk@lcca%YXg zlb1((z53>tdl)5ewLO~{@W(aPGbV;*m_@yq z!qTY3JAN1dwSq6%J#P}Te0+5klVk5cW$!ppnl4pN5rBxnk}NjD;mr^O8WxI(tuyk`0_N-ZINriG=?|u0V*1~khV8VY1|dGfHsb!! z+(Ui-?Et=|dkl0Y1P6cph=LaS8TfA9T!yz?PpqW;y^36HLg)!o#r+qiEHMP~Vi977 z$7(}MP96Xy$AJ4j@)5S$ z2snd)MC1dM)y=FAI%aa~((I9!l;V~J2~%)Ps1pnWdtN_h)#4y1#Z|)Fy9R6MzFoTe zsG`5SF9Og>19#F$6A!2U5?$CmJUloKIWH2K!Pd!8Gl`-1B`tWbEj% zwiRkjD6ZDTM|sd?csJIOZSX&P3A_*kqq5%5i_x!yzuk!p2uJdXg!FMp@@_6aB7IoK zTfZ~n1_C0XsCgX-MJnqGCJnx&_GY%K+A@wwo}wu?zoJ5#%SCTshjddm*NlVOA60_o!t^8= zI0W__5IW`8Nk&UmI_i37>*#cFxlw+_lofMOq0LpPidbt%JRf+;51US0iZ2wkzhXBU z{sXo$ZRM!4y-fB)6GIa>mYK;(pHg%hKn`sr{vXS;Aw-_P)O1OwGV)Fmp4(3wz9Z;JL^LazLgBqs3c>31Ete zkvJ1G`mg2RFVoXBnbHFFXWG}DO5nA2ddz$^Q8rNcLw=sroH}ESu(vXg%7D4dr20c9 zVNbh2>kz^V5OkSK&mtMk#;7y~;;>bHPfBU~h1=K)Dez%9_oT_M9oq@hXPaCI-KAEa zu{h^qo^D~8_;yJU*(bQ2%Oy5pYPXS<8wW+^w*v_EnVFo=7Mxz0CO69%AvIkDua;ml zz0U!d&tone{&(zC2X!Ary4j(iv_c8}woL+hqX_34lAb%E5GR|RK3+PiU)tc&EO!lKt<)6Q?q{01?$TSpi z38`d+Wo9~JQFS7;L2m6=S4)!eGXEzn&)k-^*? zd1y`4oT}4%G%!z%}xCXHc>M$mhmTVAT336kckoBel%Bj z)&g8&jvAf@O!Xhv1y`%@vuHDzBU2eIKJHE-d^ihaG#+dinEZ??qTvKcSlIFl81&S% zoHEM=3Op{yn%GAlOe-^MQu7mA{UvC{^itXKzvVGn(In#i#7D#%-g`5-t%^txqr;ss zRa0U@3P+4G!CJk))@m4Yv!C;=t6-d2%gT=&k-LlU|HZLBjegiyu>*aHJ!<&T@twR$ z^k4HAr3$u8`D~&vUEwT~q%_-kU^k{QgYV^l6xU@aP~?)2R7Ni$;PRB>bq>wO4x z2Q47emNCk?Js?qGe-5jolGaEsMPNIPaN$dtXL$dp|N+K@#;;e$!}L;e9} z9|)HU8%z}N04-t!fy*cV-| z&}2yI^chFepYwSOh4h{7N6VIfD{fU8et0cv8q!pPWz}4dDhN9|6I4wEbU6S->l0aK z?`%!J%XqGI<%f9I^uH^v<41c29XWsR#SV7|oO?9xCy>;&NqxDJX*3)v0PF5mQe}Es z@{;McY=s=QsWN-j8l0i~VYxwu_RW_Ls(MO$M{F8D_^*6~WTdgNv!&mSpEEAgV7HKY zTz%Wg9D9(mFuZm&NL&x$k&5rqgW!Yx@a3u(zOIv;Ue;XgsP!R%QYvY);a(757zH9- zc4Ud;32BE97bj;-a`!?>KVi0llNL>XV{9ku{Qmt2^8w^JR*d2BdNFU}#jr1+?>tXidnE0BuK=S-> z=h>P=fbRnz5T;}T#2o|*n;igrz#sHq*Bq9%ys)H0F?pyPCv1_YM@pkxZGk0jT@WbQ z5KDokY=z2KTuDMU4aqZi^4=l86&mO^S~CWqFJ#i%2anIL^fydaUH znXJV@%IYSNofgsOQP}Cg&4d09K3VJd-5y#GZ}o0}XOvHnK&sdphlZ&~#{|6}+ePr)l?$_|NKwLRKN(BdZ3 zo#DJ@U=>sU752Y!1jPp&lbVL#t1ET51sA7t1e0$u;%X|Ct*=X&mew+NwOB)Prz=`#`&@WnIu3xwe)a~C4 zL3v7x3@n3V8V#$U@_G!`_`vmnCMluP{oO7rK%lLl3x8yU+u<%d=vI7RcD(rIYmub< zT~sKdn`Pe^#RKp{qrZlIH+Iz?rGH+&5V9Psbt{^s~I1Ml@4D2Us9a; zf4SJtwo@OBo~(qNojBF^%Gy!d?!UHHei#89mXzm%#QE2`WDj{{{~$+0LOqi*%6P%0 z%3*@i?u*OGyVk3B*A@ywsLuGBl2XYGDBy!kJtwQF*UaS`^K4pW=iof1FET}khs3Pk z`NJ&y!b>98;h~${_Too$)x{x$R6!8lWcpKg1iM0@TPL@5L~j{1C5nuVnU4R5xHDw3 zqy^a<2LKeQ&$;g-_YXS^u5A2l7-&=BGi7NvGn(RPbh&U4IM@v9x)hMm*~+kBFCBdP zu4W6LX$?j_MX-4Jo@9aOZxENUak7i;55J?NPMBy`KM7T5ki?o8-nY?+u$qaWER8=g zX0`0P5AGVR99*~Hw`{`*p!!-^knJK}Mz1=QZU%3}(R)yvgcrj?|fbhq#uk$67 zMp4}MhtDq#SrBar_6ynA{zL$l`8iMX#AmJRP2+R3}^5MRaqpmbj8GW4!Z$hLkza1`zr z@k1u&zx9zVlB`!`#B2Lg5tCAMDrTA+UfcW6Nk5kMr}E;uAB)ID3+Z}V$xKiXWLCGu zb&@@Pb=!WfDCLy2e{fUTg0SW%7c@zmHGmJkn5=1dILIl&6ZLKPV0MRz{m^T^tnU0UCMJ`aMmWMX6AQLqmL;?q?P zsbsx@f@LdX-&7D>Q*qjpw6tK(m1T$qYAVZXr#d;VCrG*3N1uYBJ$*>h8d-xGYpn=o zUXj?>QLCMN@Z(K7T^8!Pfq%bg=|gHJDV*VtQ|Rre}=?E(~;cSh>N0a!&!`UV$bA_ zrNERQ=kmQr#)YKfW1eZN?^ZaROvEf+Yg$8b;+I~$(Pc$u*9{X-G#3IEkEt*`$QSVIog6J# zA`y-Qp5M6VpbaKYFu}LMRK3jUvBOu0mF2z1`>m?1rp5!TB?KT<)b`${2^}{Z=Kap0 z{@V3UP2Cu&xngy8UO?MRAL3Ui;OO2=NV3gbgfYwkP86@NxCxSNd?D*Z;Zxl1p2TPq zrfV*YYx>zPG-*J6HTk{i<}%v5b&p^5)+`-ncA=7+ncNZE0?ZkE3V~-}!vX1E{LVMpgh3KmU##d}~-$~?0L z!|)PA9W6o#giPgsU|Bd3WY?@A&mz2kBdC8gH59E4D;y?C1g*@8X)44>)LvUB+KSRrZn=Pa@>glXfFN%iKv9F#NG)hABKjwmrQf`7$ zE^WH##}=w5_T5xu{lMbWSxb-&^K6pkh!Q&d0xdri^MFOgdH#*LE+|n)iWM|pweW{VTV9CFXr9w? zT@lQL5&`5YX#i=(c#8(v!80ed^u*m4}!_GKMeCmXy@wwvgds+K#6l{NU|Do5{(O1B!Z{bv(e>!|OAEauS zFeCzQ!T5<^)IA>Yesp68z2Lp{xE_t0@12s0l`&0uW2#aSd@}jt+iIPR$@|wAI{##s zO~&Eqz$0ku7AcgPbRy%=czUPh9_h?#Y7j1-_uwi+$vayFT~X+LPFx#MV3UgN7xq*W zdRE@0<>|@hX2qG>alJKa2Lf$fQ{-%T4DfS`J5Uf9P!LYt8I`KK-+Y^67+c?upqH?A zbu+jCX>IsTy&Mr$c#Z{Qw{IN)7_C$@ll$C^JjFaM4UaBV3d+sjB%0sMUs6dF*N}-xms`V{CaT%m*h#p@O z>BQbq6`f=qyyS0ry8-B=tf6jBpPis4XrLe+l{eb)ECZnKA49`I8v$CsCnT;z#CU*a z3rJ6pN9ZOU#7HD0wcJsit~-$nq-<+5xq1!z^C_`6szx(sQ!bfJfwoLDM^!hV!6YSJ z+0L#W|7eCMNd}#2)Rrn)R4P|t<_mHSDlSf8mDcyxcR%pilbomaJVaG_erwu*dH6n; zqfkc$7&t{y139)h%fUV|pyCnKR07)+)&mzNl~E!yFB_feQ(|~4lV8CVewB`IK~pJV z&M*5ev^{b(giYFsq`_n9ZtN>{C@9!j#P?p^RxU&>uHm3yb=kO%=F>&qmOf-m(WdU_ z|GyTDdlZ_dFE9Y<2rhwQ#LPA(L4NcFlH`}C(gvI9b*L6E0yhqi4ydqdDEI}QbYJ#w z6s3BOr4oJ1EEBU=s*~`r&>xDG?ao@fK z-5cUhSAgf=s%@m1wL)&1?g>1;v`GxC45skT;j)yN7-vDMotdI z3OSDKnsivlGMbhGKdZ2B)r5|NC4od58dXW%bW&>Fm^=Eey|!iZb?s;alW-ume{ME6 z^-@gBV6DY|joezuIF0uoWhvV7FGr*jd;7XXF#8r@)E{3E0EdqiKw}A+tfszOT1xAM zI@Yp=1WjEk8mu1Q_};EU1QG6i8p@7^)KpTH<|>_KzF@VKS?)}5?*^>Muh{Dbomv}C zZ)MM%Wl3xss_PQ69Hptk8=e64H@5$<)w6K{ka$v-q*jkReP%Hpze^vX@;;S^oiF#p zP^ZC<|BZbn$a_rk_ND!%!^nzsbP&HxMfr4&>`&zRfbmN4n7}mH0brX_P`(N#XNl#< zmlf3~Eab19m+!$p{M;v`C0hYbGa_hx+LXnSpxzr-XRM%bQN=*EL!~-s>=JoHgqoiD zmVUtXU2Q0#koE<;u(ea_d7+7=)KNo`nZe3H+js%Zapby%dzMdg8Q?dPc>0LC=XW%$ zA&94IY=F+HD-W#y=xdOp2alN6y9Fl0=p-sQ1-ZEslOzb)HC zFhk+y8%GUGuIY{$8=Ly=tk*N+t09D{jR&g)Q+MN9*#U%VFjBCoYKH{i_rn4lrfa>o z|Ip`>IH&N+O+v3&tywmNYXlqo#0uK=MYXTRWm&c7fih5AWF1K^{7`h}&tQ%WMSXlH zROqnOkl9@Ep_(hq0c+Lm%78cqD5!7Hhd0}Sm(MfNEQPfILeGVu3nP>A1{j(9C!*9% ze%Y-f92R*nz*5!ps^FtUL*f%R2QFQZ?qg>85EhKo2PkKZ?fG5MUQ(OS#3l1T7ru+F zj{*hHy1JjQSmy((?D|kgxB4pGy3VpoV$y(Rb%Ou@QQXk+LK+jk1>2b~=1%HZh4Dy`vziB=x^Yls~C#>020lv-;?LpQ~-2kH;EQQ~}+TdG)vi3@3};f$5i3CQ3^ zYuR*OoV=rykE7K;8F2*>kUmk|ppqG+Wg5r&D9;dTq!bzT=#>%e^-IZIqXezVLBrT& z@UWkNe@2~93z#=99oN6=eT_z!x91M{2FA`8&61U;EHu_+{`Z+zQ}A4Ix8FtM{{Ptf z%BU*4w@*+36#)eWk$R*XrKLqWr8}j&J5&UuyG!Xt>KwYeI}aeufkSuCMxXyXGi%M4 zS!>pOdOykWu6^(O>iAtNOJpgMtw<0u=ihwTrl^KTyoGbW!|`F5VD^;|{;*Ck`6BwK z;R!>C7GoQZuIm}L!o>aW6XTd5)NV}ssjS7%Bne6|c$O3=(!|DcO2obc5h<%vtQa7IKA^Y(eaz^nI_J}jXD6Qbc0+zw*m zGAIlpF_r2+duF^JU?lZXDB#CXv2-iSNV9zV=2n^iF}4MD^%w0|x+=}D5%*+(Z+p)n zGcHG)kIj}gk@-va5Iz_UmCi7B(sM-TG9gZ}QMBu+aG7*L>S^TK`ae}ldtf4`t3`*4 zS+Go=c!Y$kP>Ok=f!pk;I~OzWHnjn_M&IKy?9^)CuV?9YyHgdXu4(;7Bd5 zQBNYajdS@nDLd2>L`LZ_uqL%P^s?e#6x`!(UOu7E#8ZB2dT(B!9;#i)q>$wuuwA^h z1As!TH~iTQ%?dE+i+}q5Ts+rXiQ4Zbt;Os7rw1K@bJs%jRGxR}QP$xyB(hl|UGzI{ z_&}Bl{<|`5m=#psfJY=E?{IQ)LLo3%Td_LJuKal7>!>LA_aF(-0WAGk`b#2n8oQuR zBXSrK%_V)B-RXe|Lo6jl_-`$PR(VcOtlCKd8NuQV~m%VsU#5A;sxAif^%f2W!v zV6na%<#KXl>0(A?!t>d|Xs6GdrDS?=5%hQbgnWqO&}rE3oN3R2{281Vn#d2EoVz@B zFNsQTDcvkO^}5C)G@p3%M-UpQ=)qV!vgOej0_~u zxVm?()qPlQu+IR^jSYtx)EOOxcHyV4N>Mx8W1m86nCC2Aq}jL3u;Zzt0>tq%$*_Zg z&GV8S1T?JU?YpbxzgXO#7f|@|2zNjV06!N&KF*F8sq|(Fg7m&tlTDpz=v;hi6_F}?!{@{|?Ly{}xL_P%Q^5Mf!3Uv<6(a-(z0BoMwi+9SaqTkg#>?mqAtcx z7Vh2pH*2+T)_C~?zp_=^DTZ1|e#lm#W1_Vlgs`z7dTFc5)y!=)yBXI-q93sE$jN)W zci(K*?77VK`%s(xh#R+Q~3K z_SwGZ*lrDT=#Mw+#TV5Lh&{A|&l%X$hAv(%Jbc;)oh`WA`CHg`HO0zn^yJ?xXia%> zY$BfiLyFS#=9dCN5Pa)_=e%*kN9L;KaGTbp9fi%{(1NmOTlM$WOpd2na~su$2FzP8YrqpiD@lmitMf1)uah)UIlDowLgx;4CIVWA`=~L--eODx>>w0 zq42Eoza~BAJ$%bJ8Q@=ev~=X5hW6KsUuq+grCk-ylG{ChyStG|2W^?vp5IkS1!|R| zJSPJ+XDyG$!`L6Bm17Q=bH6bt)CN0vhdsU=$w}W%*ORs^itINANY8Cb2CVGrJspQ` zb)d7%O^4T_1pw(B^m`ENeE5N!-7XZc0m)L83yNq5Ii!L#^uAxITrXC#pbdEI`eu*v z#E0BJaTx@Uo~e9t8hIOS_`46)_Yv|b{mzas8ou{kUhRy)ro0!yLl7r4i6TRolRV}n zz-b$y`%$$Iokcs&O|=MfK(P&vM=x10xL%c2mnubaFlTN1%ctRr)FX*W-I!^U`wo+i zI-^egAkap=9LUdqa}}h(l>NB8Yf;Z7cl&ARwr@Ayo=ud*FQ^{V<~}t`@2c&7K7)kz zyBVdYim}v8y6~A}!9RB7>w@1h#(aCtmq=hdK;2j1FUGnr_YR@HWSDx=ZKq)<6Hr6Q_OlXKN8P8$@+TzJM)aIEAUWv3 zRqdt7&kapo0e$O~MVW5fCL9lD+K$`%mK__~j;r%g3SKioa1-)p~6CIl7WCx&<1X52k`&E#vUN_LjxZ=#tYs}e7C}f@Xbwd?wN6I)TQcH2O z@5phbWfo`MPTKAqrfOkfq9=v|)5=zU=+cfCgud1f%5fmbfuHk`W((P-W)v1iwI)-# zTTw^evY{)a)4mqLo2YoA7YM3Gxm#068=i-tQ=<$RvO;o68E$ctQBJ1Sa@yiRVIdk} zL=b9xV0Un+?$XP$2Q1o(0S4>|1Npxj?(l%Ge|wek#Dct)dyLE%#oYoGJE@PoZ|C<; z@)J&;GVmBE7WbN<@i=`{Eg{7Dbq{hzio)Y-6WX=!z)WCDZV)D?Ctnk;_MI}L>ZwtX zq3*g$rM9E=EZfxURP~agWyVx(C)$<#uvSu-H&`7L~=IWbY`erWU!GmxK~32z&7iUb+4*)M{62<(fbyUL}X z;gLm}Me|4C>eTss;;XQP>xoXUeV5lBizj>0%{g1R)I0IYWtBK63}X;0EhH7hLQ8V% z&Om<@Nl(RSGmZ4NM3d2HhT)ech{7#I(Uv79d#if5Ql5nb4U;ciMlm(CS+y)@o4N&_ z{#9|!`p$5O@O?)9JeGu3iqbtzYq7Wpi&>&;f(%-8*3}2kD_Px)daZ;a znk{{2M~%;IcIhlz@B$u?f|ir$Ee}Uwu6A6X!*;bG+>FQSp%Jg5dz~>OjdfER!Hgc2 zT^048Zs#3gx&VRG(F35LS%gfHvX}iqLC+*XDfZHS&(dK__!}bD{u5%5pkn z7n#LZcQwzs7b~;B)y6MFzNeECGlF>$ce|L_o+43@7eQsrt6(qxD|?McH8|!+ zi~&PUPFv{vaG(@l1+Ui{n-B=zCyWgUsRQv~->GuKGC1xZjYvO^bI=im)K{aT(C@qA z#}k2~RC=rwBn4zh)Cy?h$VQQ>9B05SnMGgDWEh*k-}&|hnc&GufLcy76!=D+pO()y zOV6e(>{dC4K*$4dzk9CM>Y`JxWx|WBFFz^D&<{W;$)#;>9HC)^Y0^bktoQ4W>w!j6(8#7d2(>HFoYbWxPa;=9VaWbohWgh0wIqJUyA;R;LdJ;Q%B>TbjyysI8lR36tBt z*F(=XO&(Q%$)4OFQXseJpCeeXN$>+qW61gL^>!B8eBL!fr#{c7gZUD!vgLgBYtI!S zXjja|Ll6cT2_qA}pijQTowea`BG`{%3k?X@5@b$NY`xD?3ST+0FjMxUZ$JJg8^G?S zw~Ia13HUvWu(o;x88d}GgT)xtGEhbJ3XN_Og2@`3`$~T3kNiRX{E+Q^ne~<{-`lqr z{HS=iS}K7}2@P4>3@Yq8rqv9HtLpvr)HJtwVkF;*rWtefVj9t?7M#iwaZ`?h@=sv4 zwfFU}Ei5Trm~;xVn}N$)fwy;pv`aaXfTUMiW{s*NVx5xmAPT3tJHUh9NSUd%+&HY# zxTMlL&3Kp3e3wt5wzgX|WBPF24sXDiDOohs$f4-v{q{2Yiuo^+g*TFgl8lZVV-vqJ z7Tfl^6QX?fo4Z#GSaGz9l`X#EdP{n1-QLt(U$$Iw`J@aC(U!xf4@(c%m)9e7zU!zC z4}7VdAlTeSKR)(VGCPJQzMyDAKe6#Rvp^scd|8b3jk6U-jeLDjbz0~5vRKWi&9lSw=8yHd5Ypk-r=N=*>&*L`*@5vnFxto1Bx7H98)pfdGR2n=eWjXGX?eq@pEG%q4pLag@G(l6N7amC4vea^al|i&J zo8DR}R@#f7i!z1mpj9l$6W7y3u_#7*Ctk;1O@MHwe38G#PD zXK4WD6J!+7$M8do`F=p4;H%MORtoN>AL4I6m)cIUrudR*Z*#v^Lk%)SC<6O8lf z=qF5psNO-g+DoF4qNl#1s1Lt+F2)K-O6F$0n}TiVFnd0FZQuw7DND&}`x&?2VW+be zzom_~X4GoV_&^Em=ntJ`SqcO3YRfQCKr@#(V3pLi*Rls#8-&yhpP@}JOnGZ{I=Vbv zd}nWmSOJEUkv$!{Z0u}J-TA?XZU4QlmL)iRbc%RTHQM_$e?g0-YfP9o(q!~+csQI$ zK)aoBALEJpAlRWN8Ja5%5zs;@9Z@%L=!8y9IRmRQ-hL{9+*0rKv)e7a!eJVPt$%h8 zvxlwXPV%n=toc+k6kgGB)4uzZ16)oi(Els1D|9?|dNg+I;Kvyr2u66}yDMNz{W9!-8T&0< z9`tLV5LKyQC`jb%NvOiU<7S9Zx%z-+2|nS_vTw@MU-zVdrvN5Yxqn*2m`yO0H5hc< zo?Mjk8+8TMg;C2?Dz5B1Aqd_vuUx41yZq#^ROedQSyiDr%6|oXUUOqQldf`eBe+=* z1TPO#@lWWV%VIh;asl>;g0>-AZY#M92GUD^P`#CM{+3l=v?B??h9y~ zMbgEK3L|ktg{6D<(H}cSKkutKzK<>;y{_P=omYFkncFbMmzW3essXsRB-@|bErFiYvPPVZ!)vc1PQ;Jo_0&@kl0D?z9*FXtQcPj ztMzyy*Xeb2Z>yFNa}rRlp@L4rW1|zNHFNrboj@s2ULkLv-tte{ciH$CTWz48mk9vt z>3;gh*>45~RB=G?or>l4@9C)bya_rZli4?X!4%^{8G0Xra}r?vb}LqHx4`-lEfi1u z*B0crsH33Mi*5^f(#Zkxv0M=zRWJ)NKuSM`p!~TuZ)JF-ZpEN_Mx$H@R^oUJwq&PF zXqpF@7wo>n&Vy0BRkahDEeT^h_1*B*3BF1nqd!9mt0btk=9%&sqL0g78^dK&I$Un0 z)}&%VO>sHP=(L831;_M%{%hVcQo`WDr-<*=OcL+ER{NuA&u}OEo}J0LFz=b4z>`&#jB*MLq2J&h!&9@o{VO zwYu({G*vbgPE=Qxu5zJ}!VmFiJOnOx$?15~i*MoiUoSoRKq;xb{iFVkFColaGzrqN z@>(D)dGes>A7c6{*LM4&*F#VDg(nJR*}x2?IR?4DvV@+1ON zfuGxXg4k8DO-p573F@$PwK^6%qc6$Ol*>RS%d^KeDH`{ncFrpoa#ww_LfVm-dbo)! zN}KX_*Qg-eJhvCZzLrP|Y|~@X&Xq*6>Jb)Mo#-kBQwo)OzFd&Ne^R?l_YJ8F!jZ!` z7u8U~7G8(S~@urM;F z7b4B;``hMIlP^ua4Uc16d>O9n8Jv5w0y1}`4c~8jHO&SJHBd24L8k6Hn4Rr{AV|=S3HYCloaak< z`wC}VdCjdWA7_6SXq0pqgE?Y@A$+F?N4>(LU#-ufDpwli9}@v=&6tBABSl$mx6eSm zYym_5K>|URD$7U9KPr9aJq8;WH-ac_UusZI!9EqfaS+c$7YR^V5$QyFWeg$jR{B*H z4a?hwrRGJqS|j>0NanjXQn4K*Pu6f{_|1i_xjrH?!!ws9Lj9w`_=A z@pXIADP9D)JMFL(*+HgIoweJ3Hw*{pgB4)VKkK zdwNC9X6lE|b^zGsSGab(>>#KT*`tn^kqRQ~OSE#1W7Bc^u#Qo{gLZI!WnNyALdg9t z=FQ>IVr*mnYCcH#iPx>m$foh}*%2;;9_(sg*SPIRPiq)yx{(?5Y%xorkii72G zv$3bKYY4;r{q~+Yw0drlXJiJaPo;(TrJ7Pe-(pJ?vLR0#;$v0IykGro{+7<-2}dv8m)YC4 zsesa{czQQjDu9Ldmh99J%9}1_5ulTe#mTnV;5*2{f=w9Wn*A+_xGPUfk`r4GB;`aEQkpd)ZSj8EYN`#wd6z05IlD;7Z|)jhM^WA ztus>Vv$o>r%7U#>)(htR(8rRRcRmV^{mk*()>Zd;3{J*--*OC~DdMH*YW91nUu$@P zY3I@%DnXG!TGKa7Q{{)wyDpS`Z@6vP-JITVZ3N>4f7*HIjIf4zi!W0YT*=5h%tP6G zevw9YYww^pMsHrTRb!24C}pXeA&L8W{u3Av1j!`P!q8dIANx%jT=QRzea8yLL-H7O zg)YnEQE+IX6Mv1Rr)9RV=|VQvMQ)BwUXCSh{`?g`#N!jE`E{jFp(jq8Z$-5dcG%X>nL1+YPd`8n>(p}-c@!<}9T(=L#1zT=fIv`13~G>80;F0BH6%20Ep=KO z0GZ3ZQBrTNe&fA}fKA)muLqLW{dQM!iR-v7NV5DEzKtTAdi(B*e^7KV$q>Wpkf7E| zb50UPwrE`>jhn@}gT7YNGlI_}pRK~_pY0h14X1m5V~>LQq1Za8oiPYIDa-f;sd#Y zcDUVzqhptwmjsumY>2I*T{fjxgzSjoa(m+-%2-VIR*7s=SYwXYpqp_z#WxF#s#Rd< zcmwlq{S(??Ak?uDAm$*K*I~PSOeW-Zb-SpbcjKMsE~&Ebf96|>O94G0T`GR?Co%9X zoT16tY0BM7k%kE`yzlA7YUZW8;uPL99k*HO?e?$6l$-oT9@^m_*(*^F_^g*M=v=>eI2o^n9%Pr5?lmlmp>E{s5Nj~x!};_dDqpH0koFDG0kXL zOWPnD#(!R|Bc>!zdfifZ0}bhnRv_su>9P?TJUn@xx&A&>MiT@u~uqLW{da5j3+G9YU>3JeCn1OS>p0UCopmL8 z3)Va5{Yq;o;M3uCTO0t}RY&%wMoh~Sh?-)n+8XMApiyATWal=`dP8w(gb=MsFVnoT zyPj>(f0(eoiiNac<1>?3RvTWUwe8gK{6LVn$3CVkXcye|KCU}O{9@BW9FhXOr@k92 z$DPX>kV3QT=cdV|v-k;`e6-VCJzeysOfh3f5$LtUOm+$KsZ4Lu_Fgr*(a(bkX&MW& z3X`J>3-`@I8^j(6nA*G)9+5S!viDxTQ!GibBAY}ZA^OYq_C2zqW>#B`MNA`9hJs>6 zU#L0`aR$>~az_kgNyiXVAFZ8m=*&88qt1<*S&_>P2MZ-82E|DJjZ|l5+vKpI>~DZ=Kxi@a-b-h5%ME5J4XTS`&6 zZoq&RFO}Z-dwWjt-9z>F7N3>6E$oEZazGU>9TTV+`7({1d45!fbtSnpsc-`1EC1JqGzR>|7byEk!PP2vt36DJ<{bj?GRJu-Ds4qfdx1-m^^NoE`-XN2CT6~CW{)68e>}wpg-DpXx=y;3)#Prr zT?F!FlC3wq&qTT@3`8Rb*LA=^E4-!hi~CT z-&zk1$K0(dGS9I03{T=eGr=1MEJS;SNgMh)qtDWPFfIo|U5w&fjHgyMTYI*0Nyn<)KQ&tm=LitCT53i%K7fgfu<3Wf@sP2)f1t* zMJYz^w2-9yd&E#<*)YPk4EL-j=I2 zp{YK3I)Bny-&{u7csL1VgBG)wR{T;j>y`KvU}i=5tm*Iwk>8Vs|k+7eXO0ndvY&uPPR?yvQV4#3s%v-inRcYoC_suE5G3pt*+;hn$H zUP&!JAzC@W8O-vFiXzLSiHW3@U7<~Gdgub%`9&4qzrIwxBv2PSJ4#?u0{uE{apj@^ zwyKYp7pg^U6s;-fMC;QXaLcvNuN{V!VA$VW)3C7H&`%$o-Qa4SnWgNZG4^B#^g0ut zjn39cPK=@ctIinZ5ArI+us~YqRc}Z!Az|An>^FQ%xd;7#SBo)ivT$l~WqmCManNy& zX!1q)K2z9gBHGiqbT7K^UU)55pY62%CMtnMS~}=~&pi<2&`+t-D*n-#X1^L0nkQw! zb=}{k;epXO=~*xa0J<2L;R#e!Vf_5JeritDJ6o3mvOmV@qkm+B$RL*Y(Z+oG&ktt0 z!_{P!Yjgjmtqh!X+v1vsVJO?@%x~+zt_O8)!%dXRBz58{{hr&O1_%#~T7aO2s(yX8a?l*)v6m#lqT zDX6HNHn|CZ(<7;KDvZ5H5jTh#YJi3sGuS)bd?jf66en(W8*X(PcwqNqP^(eFCnh*6 zTPHBZ-E|Qrpidq*m@tD~HB2F8`%H3BJbFCsI-{NhaRA*g6YSdgN)|x-^{*HH5P+?C zXp^t?t{mAd&k{X0TNMs_H#56kT>DZ#d#!^qWye=gyiIiR@haS)Jc=Ys#TFSR^5OQGeh)Gwp3p0MdYBY7OnJZB0jKGQeSC zNcN<0+8LknO^1iTe#OM*nFr4bb`@uxjKvZm|JCkK%VZ7$6i>!k;5rTAu5d?%tWw6g zt=b*h-Jd>Ijf09>^zqdp15Zd-73lirKx>XCbE{klcSS4ZxEBN8*+EP7Xz5`_o~eRT z)AET}A0FWCGV}k10K~FZJ_Q_g$1yj0=ygBu&-E{Ra{O+|K_d|j^yd7TjDFJYZ+ZGBG0$k9r!7sDI7{D8-G?mk-p+JcU(&G z!QapOtm(dwXu}N}8*Y{FzXUM-rn)=fsJwB2=TzUyXh3n%mz(fN+kMD+E(Qn=vw@_b zXUSDXb-Ch|af_yA;SXyiT;Uchm29$HX|4?HE?iDGljz24%o1`JV+~l9myD4}yx+nd z3^ zuvtE%$N_pOfkL z=U^?Ts`-NT6!z?2f>=qXit4W0OMHwt*u>A-_zk#3%QUpP9B zBT#hpp_x_2jrPJ%Ivy?Vj&@(IL-Bd{tf1qKqMf7lFrp{%Jwb`WtE+t|Ig?=_Ia$M_v!=(6YVI{W z?lmyvMz!}3U(ZU12zQTf2GZc!o@_f~#$m^Qs6{*?l}_b&u{r5$SpyXz%DuVOtz1u%iCx0XpHy*s>u=Yz`Y6ztlGP zP#8gf893Kf%1AwWn}P%>vHCu zf@Snh=Wv6Gv{AYLHTxA6XNW|G2x z!x&&kMEPoT@6`rN#ph?aBoag)jEutJ!t;w(!SOHfcwJSjB!YlIEXNbE`;bA0>S0?w zmkKe;k~(&RCoiGD&g>b>y(^pHzu03^`gwVRM(iSMDcq&>pS!aOSh?_U^TZM)bYX_9 z`gI(lzb)6N*|GVE!V2F$a&T6yCrUlRE!W2jPl_MF2r(QCGZ@6m2$wA;Z}@KiG||L5 z%-EXa@g2MvZ5HJiZdOs%&h-UJylPb|zsK({o#+u7W(qbx|D=>b9xu$p;Wal;s)DK1 zi;ir~>SVR`rtMQ8_t*}^^4_Er)l$#wv?)5-up0B+2|^fO+AEt1Xy?qV<@T1X=w{zz z!G|K`@y($20XwMgiMTG{06`lW;-NzRlTDCNpm0 zYznetu>CM{(X4iP63P%pvt??2qFrEsXCB6xzDvohwz_BMMV@mMw+LGa&U5})TF}quF=FDk_9~}1H!*++63B)oqR6uKBMi^jtx;&0q5a!%L z)9^DTb;1vsL&x<&$PVTpN%3d5SJEldB#gCP80E0I$Lq3$t1l%fxT~ZboJi5zGZUeG|2~}-vVCAX*hvN3qS~h zMehJS4r3iR-s>y6={U6H#IM{Nr`onn?#G4`FVHx@ib%H?`4M6CT8L&(tUjK*zC9s^ zwL9Uwu6>!$@Z$YnKjs^P`2g;4vWiSmTX*Efw`#Mx=T;xLd#G(+eVQ)`dwpR`U1scG zw(e)=^Qjr@s>FmuLGt0WG$?y~_#a_58QE>5?L~HYMVAn#ql2w9xm=2gi0BT6MQ|yI zgEfP3OaJw>a0~Xs9(?euGxeL>h57pS4#)LVWd6DhtC?7aX_j;;joJpwIz}gf5`+;> z#v?nL4Iu}1VYv+PFA(Z(l)#gp+mdqM$bJZa{2}YQfjOR&ju{}8v_6cVtk+#RUx zmRN|<8#@_jD9!>gkYu-1!;2iXH^TJ)AW=cFD%=0_=v)A4&~UBK=7x*KzTxWD`<96@ zli-t<++b7ad?)edwFZ{6HJd224P7Ke6VDVK38^B%b87=}>u!J2pT-!Vm7eR~$y?8V z_`9Z)I2dn48VUM2G>0K(#3V10vBUt*Bdqq1B{I_I-u_AB1y?5c_CW{t@nBqE1gzfD ze0LeE^VaQRSDFJER#(hs3AZY~kAy@&IX8Z}cb~xfP{r!fd1034;B=DrxTtuRo#V7G zjn95x7Axhl{`TbD`-%yV^44PK+RUCCsZ@zrT#+WE;bNsttbk0i&TFH)(9t3QK6?)d zNyT_)V}E)wO!J~!<5-qYl7r1*!PR|ccJ+n`PWd^hz4F8oPJJdnfu!98X-05cRc5OB&^lXja+EC#W7c^H>wi%$U2Lz zfGaZBsW6t2p|r&a2}u_N4sUdBExCckdLM^Duadl9F;zUS>PtI6TDm>oufDzF=f9jA z@xAtDc0O{6KFUF>@+~x*i6rP!>Rm{)AZS)g@z^hr*Z}WrE^!Je+VbAd>%U!sT3{Z%lE!-mbJ#Mc^u55O4I@4XN(QPDEuWK0M`aec5DA4mo z$*M35&fy{omtLyG4rY@Rd1iWTd^X4$DG^)I$k@xZ<;yjFBoCC78yy1+T7-n_86kmYk+H5-72Z}ir-B<=&(2iZeqiNL;rD)B-+blaxpsISMKVzDcrX(p0r{mq0s9yb;o}a5Mf_L1wG4rdzcyi#FUt{Vlsj=)l?Y4FH=DHDf zP;%Ryy+Eve8zg(|wY;U}3^|T$WaW0Qb28ne!t1%c)P$e%U#2WvUOAt7?(5wCZn?c^ zEVr&>xgDN9GD6~jZHAIx>~%KYQmv<+abt;!YI~hWiF#iL6n8IqyPcOe8{baru2Ftr zk9>%PRF-Gno4w<{v*T%_I|pqjy;)EDetXP!AmDskKL=fy7@yO+UGiY%U#K&@zVba+ zFkTBKPP^`Hjl*nkg8x23M4YbipHT-|ms@E~W{31AA!`;$g^-(tQm9YFQSjG6Iin?2 z%38!ok&sj~HjmF0NCs78+0aP(mG}$257cVR^NOVjYMtk2N7Jsh<`cFWwhEY%krK-| z?mJkPacaxZtujhUMZfz)LTco^nxWoroJr3)yz3w%;pxR8TeZ8rr-(iZHaB0UrnsK} z(D`plC4O()8zIZ$h(-^!voco&S#RvxOkN$xeCiHTm+H(&VidL3Amg3Xg}sX0TXnfR zlYFtaGcA)lR-z>?MH~_NjcK2M5gj(e90RG4y-K$Hvjz%^*3fxtUnY{iG_}_r(-o!b zUv5Gcu2+j^ttB~-p^?EMHJD*0AQAx&!@c%%qqMl{<;rs$aM?NQ-0&|r z^yG-|#-`>TOoEvs(quYV2xGbcO!o$ok1^^S(=JtMFYI!>*s-4A7L=b%9A{sC*66Ox zW|-@DL_$J}h0j!!o-U$I+_pp|-3*r#q+PPfq1(jt0Sp>z@JdL(?s)=kM?&I)qbhbY zsEo$oI^O;M%tof*sgWPG(8yy3o`h7DP;`+jB)4`^su^%c&`3>>na817dn>v%55O;* zAk{hAYTt;`T*c(VtOD>qNF4RQ$pRvWKg2k=Qsl1y34~D5uTSj#CsNe0LX)^6~hn zT=`cFp75@pEvn27)RKMTcgrvQhs+-PZZ)uUZe}|)=6`VEXYMy5$dAzdJCNd7sGqZC3$#y8`^$&>> zX274XAfxfY6wHQgOk7}rA^PRHOC4YzKlQ+8#C-z5)t@nYy<%Y5naWm{vZZHI>g3Qe z>k5bTdXt?40?j11`ipsUI5Rj;AW0fJXTJ`)9Epjk9Eqt6hm27MEw93+gbKb&7P|dV zO`fTbhiJmtCw09VE}GH)y=XpY9lCHkUfTUiLPL3@BC?H6q4pHlKQT)qQbTx>2tw|u zftiT>3Ou0d>ntkj1*%m({tw9**xttKvX9+|R-f^M8zU{)=1NeEviRM%`i$A*vJjiu z+cOg2_t=t1H9u;(-OfHWy}2|XqVfGy`d@BaI z{-KzM;&=KC>1kvI3i#(A@;_$@h~4oV(&z9yMnXb*E&hk71tTGMzrK>RQ)@v5_Dg`ufZviPSX%1&>B?v&`<+Pgu47RqDZjZR`I_<_;2tLBUS2mlH#ZK3hD8pBMcE7? zE{0~O^GhGg!Gvj6^}u3o3-OWINo~ovJ7G6tQL~=Py<5wqr8Yeys}YI+g8;c#tgeXb zUFwko4WGSlKzfNpy*97Qo4+@=pKTIYXcDL?D^sp1^Vtl{k`}7^?@>F3bN>xf-KNc6W!Fa|*OeI{8D1d27rki`TN*e*RIUS}^Wt z>*C43`W0|&crRQ2;N$}5fnJSZtY*Hmv*>YZ@rpOi^jnSH&?Ez`Nsk&Cqqc2qsEq7n z9W}3cU6SF1Ca)LM)`4HFv`n%^;A|FMpj!&tG!93%W<9r6V%3+f#Et-k-DAJlx8=uG z;>9QCP1%malZ{T+e>qcmG*+aJxzgR*Hdn1C3s^hClLQcP$w;BT}X=w$Mm+Z%xTLvOmRww&?h!p7Y38yLZ8p60diT$X}+62y(V7n-P9fWSb zuNGAtMPY1Y1hqh@?Y4Et4>rUHmAvAxK4SaF-e`R*&4b!1nD?5w#xnY)1J3l`h3sIPwc+dzEWS7j zpCpA>hxfXjg9Mfc7U}J{vYc{iRlRkB0q2_D+u4_$JU)TN%|?PV*9Qh0T#pb?;_6x| zxR(%w@ZAY~Erj>_l+(5>%k2Wzw;o5_a2x8t`|VE7WmL9^*`5iRvdYn)h6SkKkrTb@ zC{e<}2X`uYajZXf%>awV6L8@F&K42Oc64^kl584>&(<+&kxEXSUNrR=A8%F2h*)Ya zL@^?(bWS35g%-Qj6W?;W9c>hA)g~r^ryx}+7dZ&e2>K~vJrBAp*cbG=GyWQ?OYyo`5ss3_VGD*ZV_mbtXwQTA6Jy zd#YnjpXy=ivEqzLKi5xNKz!y^ARGx%H3^Q-h8J#r*$?pTP@Q1iFOJy1Ki*-d!D8z} zu`XPAJvPKjY+b+6y*{us z4ptt$GOq2iidT{HUNXtFdy@^SK&SQgV*;W;ra`rP7vG99sA=_2eL5c|o@(-t1)X9{%$!Bf5wnAB<&)?;)41Iew<|Ie(j}@j>7L}M2>34Yp7#VrO%BV9;4+se zC*-d>V?i1`S5fWcR+T1?QslWOHougZmSvWeD5_m)mJlXd-A=>|o{Em=1!5f%&^0(| z)={ecFlCkmi#Rr5=-FmuEfI(v0*~W;Be!E+Ut*dVDye-ak;j?f!D0SDZ;<^^LV8pW zNIV_Hl>lG9Qk2mMEB?sC_8C6sNTYm0GtC}y6;_`h@2RC4v)A(F4 zPW?Se;W38>;0=uSn}ZFL!x9Y#?Zd&wNyU#L1Qh%gP}dQu;N!TUB1yM0-5Q6D+5Qe1 z%yrtV6VBi#-%DO*@MgdtJ}mnQoGZ@C+ISC+g4j;cppHxfp$uJHNAFU6VvEU%g|G~`=rPM9as(*y&Vi++ENO&a$J#4ne8d41GsHj$DnvW2UN78N5gd-+ue zbL^3Y^v#JpEUIKDP3&eT-Ly=1aaXUjl&EtFRZJc1tN2K1u2#mnoRw%@>9Ag-)=0^! z+W~N>65{9(14=pB8giZ^)5VrmWE_IW0=A3Gbs^c^#Vt`j+iVVz|Ijzq+H9vi(@cX{ ztCpS}yyeiexEf={&oHFP*s$ULJ^k^Kl!tq)<`fd@4%-P50%>_(L#KNl-HA0 z+K)U(%AGBC1tD&nBE}b)okXFDO{ao;`FI4k%v$`*My6GlKFvp~?*_?E$7T9yZvnei zcFPwG+Q@TzzTKup;19^gjeZf9?8zV1OQhs}<(rEu>1m#b8PvGM82ipddp2j($s}<= za&t*%5sNl4yZqID&r&dZ$kIRPlY!uZM4V!V=RAOXBMDv+Yi_)pKZBX}SJpVxY z2tL|0A5|)uTqY3>Bc7`?SFy)&P|RXYjE>b*-u)r>HuHR;{w-!%X?srG^VwQI(?l6{kK>ZP3$Q+O^AzCBPCPjUZzLBo znE2u`)HHD*UmCZw7kyzQ*6Z02Ys%P(mD4$gf%NFJ?q2O$1WJiaC|+;>p852;j61iM zlkLT-Iy~^NZ~IxfM*pu*@c-Gp70?~OpVh5i_Hmkni;GXq(xT2RW~4!)<{?s{G;p;4 z(a1*&%#e&O=6BDP?&wtCztL$ptpP$Y?~5R#R;`oo;>|&B6AIGAoeLlS-nTR$yHrq- zM$7&*90iEg<);`iBO50B0<#gZ2#hRw+Ht=|j%Znx649H4#TEw|k0%e1VAOZd>3!Vl zejvB4`bl%()kofs#Vby?7+ermibluP_O1SSq|Y)@z{58e{e&3&N|C}p(@DbMq^m|q zr%1!*rF=@oA!+@~gIsRp-0*#=noE}H&nt;7RJvpCJmu{C^EuyDA`RTMlO;U@Sx&xz zB_9Y0YaN3V^==&$s(GSm0g;w_s6MDwlHhxk?rGzv~s}vT<7f6k#!$Pyr zN@9W*!bAxCi3kc~J7>dQ@tYjR?~|?3WkJ4E0WUGX)4>Y)bLE|{YM=t*$mzMfrltuFev!U8<`6GHijVw!)&De8So2^o7;`?4a>x1fhe|5@$d?j?;mO z+|(~{x8RSL$wDewZ$|2DD|z_bSftW43ntQgQ7Mp-%)bGeR>fi5vKWcaGcgsPA1L{*R_Z=pk5kU7ucPZ%>U!a{-r#U1D<447=)Na`FF~eFg%5S|*TatjGp@5B*BEU9R7%jwSX9z3V@IDVlbo(R76 zyC787atv<4HhaNH#YoC#_sodKJtXshyG4=NeQ2+5mHYH~UDdSa4Z9qn+1fMHggBux z&!4p0^5;KyG1kpj&u)SggqX~p7pBOBDZofDcI!9gq%0%HjHdhgeLiIj3mxXJnw08W zeb7V9`oF48Y?RqTrdz!pH?q`4(q-7ppWNCH%McCQnW-$OeuVUSO9kY~IDfG!Re#<5 zqMw1f_kuLVU@~AaAi^BW9qDtZSr**|AixJoFX?vpAervHm3h&^3`oB^?tJNcz5Fb( zn6@>Cn9<%fd{|L>w+|9iyYPe@eGpX#*UuC99Objq6NG-bPg zb=>|e%QL1(JTo?C4}-(3v|N*s*83bU`NuDj+Q%o^?< zncUo8ASQ_u0kymrgVYxoJ!9Xz6Bb^9t(SE8pJudq-Hr zd)39HpZH#qG+Nt}d7HqNeHeVO*svOZ!MDRQf`*9}zVD7tC4b-5 z_TrzMiiB-$uVoOX!cH@)n``I2ZW?b5=6-(|9`WZqJ#nxc%e9NBQvOavW;pF$ILz&U=hg#^G!(p`jrmEV7o+YyB(~ zLIp*<)@QL+jLhLYI0}u5p*yCiKFkxmIFcbL?0e#|y;&1%AxpAe8?sQp`nY6#PUF&O zpiPwjYNxy5l0+@>M3d!Dv=?^d^nBza8NQGGL5%1B*hcZV`7b0aukwwq0Er}f<#pt=s&-;&I!&RFpNhjn=13e}f^lf1lE%(44X zb1U%a%egOgr+NQsTe5Cd!kcfqC)X)0x9fUW|Ky_Er=lN^XUfL!o>g79(p~@AV&=?R~j!`T6hP`EI3K;1p0={86)cK~BzX=kN3X zf8?K(wPoXyS8o@W$5vFox|;I$(pzi0s`OQXOUiElVXy!Acx4*r?Z$TYbN>GWtNM@K zJIlPYRkyg-+HUWTOwXxzj%?fcDqiMhz>ljx949-=-i-Kh_1KBUKX&esw4a``^RJ>* zXwhtT%ei{n#FzEH|C;yZ>+$!u_x#*+`=L8{b9SH^9&27u3G_Gxqxe`L2UJtdxghk z&-wzDFvLvW{chK5u3{n6GSKKy!P&C6w^IFpbD0bcp^A{{2lcLh_DXj@ybtYvc^;(2 M)78&qol`;+0Fu7JivR!s diff --git a/docs/output.md b/docs/output.md index 87f26cce..0feb2b19 100644 --- a/docs/output.md +++ b/docs/output.md @@ -14,6 +14,7 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d - [FastQC](#fastqc) - Raw read QC - [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline + - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution ### FastQC @@ -29,16 +30,6 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d [FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). -![MultiQC - FastQC sequence counts plot](images/mqc_fastqc_counts.png) - -![MultiQC - FastQC mean quality scores plot](images/mqc_fastqc_quality.png) - -![MultiQC - FastQC adapter content plot](images/mqc_fastqc_adapter.png) - -:::note -The FastQC plots displayed in the MultiQC report shows _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality. -::: - ### MultiQC
diff --git a/docs/usage.md b/docs/usage.md index bb10023b..d80916b3 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -85,9 +85,9 @@ The above pipeline run specified with a params file in yaml format: nextflow run nf-core/bacass -profile docker -params-file params.yaml ``` -with `params.yaml` containing: +with: -```yaml +```yaml title="params.yaml" input: './samplesheet.csv' outdir: './results/' genome: 'GRCh37' @@ -199,14 +199,6 @@ See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config If you have any questions or issues please send us a message on [Slack](https://nf-co.re/join/slack) on the [`#configs` channel](https://nfcore.slack.com/channels/configs). -## Azure Resource Requests - -To be used with the `azurebatch` profile by specifying the `-profile azurebatch`. -We recommend providing a compute `params.vm_type` of `Standard_D16_v3` VMs by default but these options can be changed if required. - -Note that the choice of VM size depends on your quota and the overall workload during the analysis. -For a thorough list, please refer the [Azure Sizes for virtual machines in Azure](https://docs.microsoft.com/en-us/azure/virtual-machines/sizes). - ## Running in the background Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished. diff --git a/main.nf b/main.nf index 4111c7c2..6402f62e 100644 --- a/main.nf +++ b/main.nf @@ -9,8 +9,6 @@ ---------------------------------------------------------------------------------------- */ -nextflow.enable.dsl = 2 - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS / WORKFLOWS @@ -20,7 +18,6 @@ nextflow.enable.dsl = 2 include { BACASS } from './workflows/bacass' include { PIPELINE_INITIALISATION } from './subworkflows/local/utils_nfcore_bacass_pipeline' include { PIPELINE_COMPLETION } from './subworkflows/local/utils_nfcore_bacass_pipeline' - include { getGenomeAttribute } from './subworkflows/local/utils_nfcore_bacass_pipeline' /* @@ -56,10 +53,8 @@ workflow NFCORE_BACASS { BACASS ( samplesheet ) - emit: multiqc_report = BACASS.out.multiqc_report // channel: /path/to/multiqc_report.html - } /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -70,27 +65,24 @@ workflow NFCORE_BACASS { workflow { main: - // // SUBWORKFLOW: Run initialisation tasks // PIPELINE_INITIALISATION ( params.version, - params.help, params.validate_params, params.monochrome_logs, args, params.outdir, params.input ) - + // // WORKFLOW: Run main workflow // NFCORE_BACASS ( PIPELINE_INITIALISATION.out.samplesheet ) - // // SUBWORKFLOW: Run completion tasks // diff --git a/modules.json b/modules.json index 3a430510..dcbf6276 100644 --- a/modules.json +++ b/modules.json @@ -7,12 +7,12 @@ "nf-core": { "fastqc": { "branch": "master", - "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "b7ebe95761cd389603f9cc0e0dc384c0f663815a", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] } } @@ -21,17 +21,17 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "d20fb2a9cc3e2835e9d067d1046a63252eb17352", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "92de218a329bfc9a9033116eb5f65fd270e72ba3", + "git_sha": "2fdce49d30c0254f76bc0f13c55c17455c1251ab", "installed_by": ["subworkflows"] }, - "utils_nfvalidation_plugin": { + "utils_nfschema_plugin": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "bbd5a41f4535a8defafe6080e00ea74c45f4f96c", "installed_by": ["subworkflows"] } } diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml index 1787b38a..691d4c76 100644 --- a/modules/nf-core/fastqc/environment.yml +++ b/modules/nf-core/fastqc/environment.yml @@ -1,7 +1,5 @@ -name: fastqc channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index d79f1c86..d8989f48 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -26,7 +26,10 @@ process FASTQC { def rename_to = old_new_pairs*.join(' ').join(' ') def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') - def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') + // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) + // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 + // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label + def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') / task.cpus // FastQC memory value allowed range (100 - 10000) def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index ee5507e0..4827da7a 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -16,35 +16,44 @@ tools: homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/ licence: ["GPL-2.0-only"] + identifier: biotools:fastqc input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - html: - type: file - description: FastQC report - pattern: "*_{fastqc.html}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.html": + type: file + description: FastQC report + pattern: "*_{fastqc.html}" - zip: - type: file - description: FastQC report archive - pattern: "*_{fastqc.zip}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.zip": + type: file + description: FastQC report archive + pattern: "*_{fastqc.zip}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index 70edae4d..e9d79a07 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -23,17 +23,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. - // looks like this:
Mon 2 Oct 2023
test.gz
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_single") } + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -54,16 +51,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_paired") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -83,13 +78,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -109,13 +102,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_bam") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -138,22 +129,20 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, - { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, - { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -173,21 +162,18 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } test("sarscov2 single-end [fastq] - stub") { - options "-stub" - + options "-stub" when { process { """ @@ -201,12 +187,123 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert snapshot(process.out.html.collect { file(it[1]).getName() } + - process.out.zip.collect { file(it[1]).getName() } + - process.out.versions ).match("fastqc_stub") } + { assert process.success }, + { assert snapshot(process.out).match() } ) } } + test("sarscov2 paired-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 interleaved [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 multiple [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 custom_prefix - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index 86f7c311..d5db3092 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,88 +1,392 @@ { - "fastqc_versions_interleaved": { + "sarscov2 custom_prefix": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:07.293713" + "timestamp": "2024-07-22T11:02:16.374038" }, - "fastqc_stub": { + "sarscov2 single-end [fastq] - stub": { "content": [ - [ - "test.html", - "test.zip", - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:24.993809" + }, + "sarscov2 custom_prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:31:01.425198" + "timestamp": "2024-07-22T11:03:10.93942" }, - "fastqc_versions_multiple": { + "sarscov2 interleaved [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:55.797907" + "timestamp": "2024-07-22T11:01:42.355718" }, - "fastqc_versions_bam": { + "sarscov2 paired-end [bam]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:26.795862" + "timestamp": "2024-07-22T11:01:53.276274" }, - "fastqc_versions_single": { + "sarscov2 multiple [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:27.043675" + "timestamp": "2024-07-22T11:02:05.527626" }, - "fastqc_versions_paired": { + "sarscov2 paired-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:31.188871" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:34.273566" + }, + "sarscov2 multiple [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:47.584191" + "timestamp": "2024-07-22T11:03:02.304411" }, - "fastqc_versions_custom_prefix": { + "sarscov2 single-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:19.095607" + }, + "sarscov2 interleaved [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:44.640184" + }, + "sarscov2 paired-end [bam] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:41:14.576531" + "timestamp": "2024-07-22T11:02:53.550742" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index ca39fb67..f1cd99b0 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -1,7 +1,5 @@ -name: multiqc channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::multiqc=1.21 + - bioconda::multiqc=1.24.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 47ac352f..b9ccebdb 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,14 +3,16 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.21--pyhdfd78af_0' : - 'biocontainers/multiqc:1.21--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" path(multiqc_config) path(extra_multiqc_config) path(multiqc_logo) + path(replace_names) + path(sample_names) output: path "*multiqc_report.html", emit: report @@ -23,16 +25,22 @@ process MULTIQC { script: def args = task.ext.args ?: '' + def prefix = task.ext.prefix ? "--filename ${task.ext.prefix}.html" : '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' - def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' + def logo = multiqc_logo ? "--cl-config 'custom_logo: \"${multiqc_logo}\"'" : '' + def replace = replace_names ? "--replace-names ${replace_names}" : '' + def samples = sample_names ? "--sample-names ${sample_names}" : '' """ multiqc \\ --force \\ $args \\ $config \\ + $prefix \\ $extra_config \\ $logo \\ + $replace \\ + $samples \\ . cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index 45a9bc35..b16c1879 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,5 +1,6 @@ name: multiqc -description: Aggregate results from bioinformatics analyses across many samples into a single report +description: Aggregate results from bioinformatics analyses across many samples into + a single report keywords: - QC - bioinformatics tools @@ -12,40 +13,59 @@ tools: homepage: https://multiqc.info/ documentation: https://multiqc.info/docs/ licence: ["GPL-3.0-or-later"] + identifier: biotools:multiqc input: - - multiqc_files: - type: file - description: | - List of reports / files recognised by MultiQC, for example the html and zip output of FastQC - - multiqc_config: - type: file - description: Optional config yml for MultiQC - pattern: "*.{yml,yaml}" - - extra_multiqc_config: - type: file - description: Second optional config yml for MultiQC. Will override common sections in multiqc_config. - pattern: "*.{yml,yaml}" - - multiqc_logo: - type: file - description: Optional logo file for MultiQC - pattern: "*.{png}" + - - multiqc_files: + type: file + description: | + List of reports / files recognised by MultiQC, for example the html and zip output of FastQC + - - multiqc_config: + type: file + description: Optional config yml for MultiQC + pattern: "*.{yml,yaml}" + - - extra_multiqc_config: + type: file + description: Second optional config yml for MultiQC. Will override common sections + in multiqc_config. + pattern: "*.{yml,yaml}" + - - multiqc_logo: + type: file + description: Optional logo file for MultiQC + pattern: "*.{png}" + - - replace_names: + type: file + description: | + Optional two-column sample renaming file. First column a set of + patterns, second column a set of corresponding replacements. Passed via + MultiQC's `--replace-names` option. + pattern: "*.{tsv}" + - - sample_names: + type: file + description: | + Optional TSV file with headers, passed to the MultiQC --sample_names + argument. + pattern: "*.{tsv}" output: - report: - type: file - description: MultiQC report file - pattern: "multiqc_report.html" + - "*multiqc_report.html": + type: file + description: MultiQC report file + pattern: "multiqc_report.html" - data: - type: directory - description: MultiQC data dir - pattern: "multiqc_data" + - "*_data": + type: directory + description: MultiQC data dir + pattern: "multiqc_data" - plots: - type: file - description: Plots created by MultiQC - pattern: "*_data" + - "*_plots": + type: file + description: Plots created by MultiQC + pattern: "*_data" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@abhi18av" - "@bunop" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test index f1c4242e..33316a7d 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -8,6 +8,8 @@ nextflow_process { tag "modules_nfcore" tag "multiqc" + config "./nextflow.config" + test("sarscov2 single-end [fastqc]") { when { @@ -17,6 +19,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -41,6 +45,8 @@ nextflow_process { input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -66,6 +72,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index bfebd802..b779e469 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:48:55.657331" + "timestamp": "2024-07-10T12:41:34.562023" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:49:49.071937" + "timestamp": "2024-07-10T11:27:11.933869532" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-29T08:49:25.457567" + "timestamp": "2024-07-10T11:26:56.709849369" } -} \ No newline at end of file +} diff --git a/modules/nf-core/multiqc/tests/nextflow.config b/modules/nf-core/multiqc/tests/nextflow.config new file mode 100644 index 00000000..c537a6a3 --- /dev/null +++ b/modules/nf-core/multiqc/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'MULTIQC' { + ext.prefix = null + } +} diff --git a/nextflow.config b/nextflow.config index 6ed459cb..d2b37edb 100644 --- a/nextflow.config +++ b/nextflow.config @@ -16,7 +16,6 @@ params { genome = null igenomes_base = 's3://ngi-igenomes/igenomes/' igenomes_ignore = false - // MultiQC options multiqc_config = null multiqc_title = null @@ -33,48 +32,26 @@ params { monochrome_logs = false hook_url = null help = false + help_full = false + show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' - // Config options config_profile_name = null config_profile_description = null + custom_config_version = 'master' custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" config_profile_contact = null config_profile_url = null - - // Max resource options - // Defaults only, expecting to be overwritten - max_memory = '128.GB' - max_cpus = 16 - max_time = '240.h' - // Schema validation default options - validationFailUnrecognisedParams = false - validationLenientMode = false - validationSchemaIgnoreParams = 'genomes,igenomes_base' - validationShowHiddenParams = false - validate_params = true - + validate_params = true + } // Load base.config by default for all pipelines includeConfig 'conf/base.config' -// Load nf-core custom profiles from different Institutions -try { - includeConfig "${params.custom_config_base}/nfcore_custom.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config") -} - -// Load nf-core/bacass custom profiles from different institutions. -try { - includeConfig "${params.custom_config_base}/pipeline/bacass.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config/bacass profiles: ${params.custom_config_base}/pipeline/bacass.config") -} profiles { debug { dumpHashes = true @@ -89,7 +66,7 @@ profiles { podman.enabled = false shifter.enabled = false charliecloud.enabled = false - conda.channels = ['conda-forge', 'bioconda', 'defaults'] + conda.channels = ['conda-forge', 'bioconda'] apptainer.enabled = false } mamba { @@ -178,25 +155,23 @@ profiles { test_full { includeConfig 'conf/test_full.config' } } -// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile -// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled -// Set to your registry if you have a mirror of containers -apptainer.registry = 'quay.io' -docker.registry = 'quay.io' -podman.registry = 'quay.io' -singularity.registry = 'quay.io' +// Load nf-core custom profiles from different Institutions +includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null" -// Nextflow plugins -plugins { - id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet -} +// Load nf-core/bacass custom profiles from different institutions. +// TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs +// includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/bacass.config" : "/dev/null" +// Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile +// Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled +// Set to your registry if you have a mirror of containers +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' +charliecloud.registry = 'quay.io' // Load igenomes.config if required -if (!params.igenomes_ignore) { - includeConfig 'conf/igenomes.config' -} else { - params.genomes = [:] -} +includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. // See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. @@ -208,8 +183,15 @@ env { JULIA_DEPOT_PATH = "/usr/local/share/julia" } -// Capture exit codes from upstream processes when piping -process.shell = ['/bin/bash', '-euo', 'pipefail'] +// Set bash options +process.shell = """\ +bash + +set -e # Exit if a tool returns a non-zero status/exit code +set -u # Treat unset variables and parameters as an error +set -o pipefail # Returns the status of the last command to exit with a non-zero status or zero if all successfully execute +set -C # No clobber - prevent output redirection from overwriting files. +""" // Disable process selector warnings by default. Use debug profile to enable warnings. nextflow.enable.configProcessNamesValidation = false @@ -238,43 +220,47 @@ manifest { homePage = 'https://github.com/nf-core/bacass' description = """Simple bacterial assembly and annotation""" mainScript = 'main.nf' - nextflowVersion = '!>=23.04.0' - version = '2.3.0dev' + nextflowVersion = '!>=24.04.2' + version = '2.4.0dev' doi = '' } -// Load modules.config for DSL2 module specific options -includeConfig 'conf/modules.config' +// Nextflow plugins +plugins { + id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet +} + +validation { + defaultIgnoreParams = ["genomes"] + help { + enabled = true + command = "nextflow run $manifest.name -profile --input samplesheet.csv --outdir " + fullParameter = "help_full" + showHiddenParameter = "show_hidden" + beforeText = """ +-\033[2m----------------------------------------------------\033[0m- + \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m +\033[0;34m ___ __ __ __ ___ \033[0;32m/,-._.--~\'\033[0m +\033[0;34m |\\ | |__ __ / ` / \\ |__) |__ \033[0;33m} {\033[0m +\033[0;34m | \\| | \\__, \\__/ | \\ |___ \033[0;32m\\`-._,-`-,\033[0m + \033[0;32m`._,._,\'\033[0m +\033[0;35m ${manifest.name} ${manifest.version}\033[0m +-\033[2m----------------------------------------------------\033[0m- +""" + afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} +* The nf-core framework + https://doi.org/10.1038/s41587-020-0439-x -// Function to ensure that resource requirements don't go beyond -// a maximum limit -def check_max(obj, type) { - if (type == 'memory') { - try { - if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1) - return params.max_memory as nextflow.util.MemoryUnit - else - return obj - } catch (all) { - println " ### ERROR ### Max memory '${params.max_memory}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'time') { - try { - if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1) - return params.max_time as nextflow.util.Duration - else - return obj - } catch (all) { - println " ### ERROR ### Max time '${params.max_time}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'cpus') { - try { - return Math.min( obj, params.max_cpus as int ) - } catch (all) { - println " ### ERROR ### Max cpus '${params.max_cpus}' is not valid! Using default value: $obj" - return obj - } +* Software dependencies + https://github.com/${manifest.name}/blob/master/CITATIONS.md +""" + } + summary { + beforeText = validation.help.beforeText + afterText = validation.help.afterText } } + +// Load modules.config for DSL2 module specific options +includeConfig 'conf/modules.config' + diff --git a/nextflow_schema.json b/nextflow_schema.json index 9fcff48f..6c25907f 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -1,10 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/bacass/master/nextflow_schema.json", "title": "nf-core/bacass pipeline parameters", "description": "Simple bacterial assembly and annotation", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", @@ -71,6 +71,14 @@ "fa_icon": "fas fa-ban", "hidden": true, "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`." + }, + "igenomes_base": { + "type": "string", + "format": "directory-path", + "description": "The base path to the igenomes reference files", + "fa_icon": "fas fa-ban", + "hidden": true, + "default": "s3://ngi-igenomes/igenomes/" } } }, @@ -122,41 +130,6 @@ } } }, - "max_job_request_options": { - "title": "Max job request options", - "type": "object", - "fa_icon": "fab fa-acquisitions-incorporated", - "description": "Set the top limit for requested resources for any single job.", - "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.", - "properties": { - "max_cpus": { - "type": "integer", - "description": "Maximum number of CPUs that can be requested for any single job.", - "default": 16, - "fa_icon": "fas fa-microchip", - "hidden": true, - "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`" - }, - "max_memory": { - "type": "string", - "description": "Maximum amount of memory that can be requested for any single job.", - "default": "128.GB", - "fa_icon": "fas fa-memory", - "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", - "hidden": true, - "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`" - }, - "max_time": { - "type": "string", - "description": "Maximum amount of time that can be requested for any single job.", - "default": "240.h", - "fa_icon": "far fa-clock", - "pattern": "^(\\d+\\.?\\s*(s|m|h|d|day)\\s*)+$", - "hidden": true, - "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`" - } - } - }, "generic_options": { "title": "Generic options", "type": "object", @@ -164,12 +137,6 @@ "description": "Less common options for the pipeline, typically set in a config file.", "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", "properties": { - "help": { - "type": "boolean", - "description": "Display help text.", - "fa_icon": "fas fa-question-circle", - "hidden": true - }, "version": { "type": "boolean", "description": "Display version and exit.", @@ -245,27 +212,6 @@ "fa_icon": "fas fa-check-square", "hidden": true }, - "validationShowHiddenParams": { - "type": "boolean", - "fa_icon": "far fa-eye-slash", - "description": "Show all params when using `--help`", - "hidden": true, - "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters." - }, - "validationFailUnrecognisedParams": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters fails when an unrecognised parameter is found.", - "hidden": true, - "help_text": "By default, when an unrecognised parameter is found, it returns a warinig." - }, - "validationLenientMode": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters in lenient more.", - "hidden": true, - "help_text": "Allows string values that are parseable as numbers or booleans. For further information see [JSONSchema docs](https://github.com/everit-org/json-schema#lenient-mode)." - }, "pipelines_testdata_base_path": { "type": "string", "fa_icon": "far fa-check-circle", @@ -278,19 +224,16 @@ }, "allOf": [ { - "$ref": "#/definitions/input_output_options" - }, - { - "$ref": "#/definitions/reference_genome_options" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/institutional_config_options" + "$ref": "#/$defs/reference_genome_options" }, { - "$ref": "#/definitions/max_job_request_options" + "$ref": "#/$defs/institutional_config_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf b/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf index 5d43bdd1..68dab7db 100644 --- a/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf @@ -8,17 +8,14 @@ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { UTILS_NFVALIDATION_PLUGIN } from '../../nf-core/utils_nfvalidation_plugin' -include { paramsSummaryMap } from 'plugin/nf-validation' -include { fromSamplesheet } from 'plugin/nf-validation' -include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' +include { UTILS_NFSCHEMA_PLUGIN } from '../../nf-core/utils_nfschema_plugin' +include { paramsSummaryMap } from 'plugin/nf-schema' +include { samplesheetToList } from 'plugin/nf-schema' include { completionEmail } from '../../nf-core/utils_nfcore_pipeline' include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' -include { dashedLine } from '../../nf-core/utils_nfcore_pipeline' -include { nfCoreLogo } from '../../nf-core/utils_nfcore_pipeline' include { imNotification } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' -include { workflowCitation } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' /* ======================================================================================== @@ -30,7 +27,6 @@ workflow PIPELINE_INITIALISATION { take: version // boolean: Display version and exit - help // boolean: Display help text validate_params // boolean: Boolean whether to validate parameters against the schema at runtime monochrome_logs // boolean: Do not use coloured log outputs nextflow_cli_args // array: List of positional nextflow CLI args @@ -51,20 +47,16 @@ workflow PIPELINE_INITIALISATION { workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 ) + // // Validate parameters and generate parameter summary to stdout // - pre_help_text = nfCoreLogo(monochrome_logs) - post_help_text = '\n' + workflowCitation() + '\n' + dashedLine(monochrome_logs) - def String workflow_command = "nextflow run ${workflow.manifest.name} -profile --input samplesheet.csv --outdir " - UTILS_NFVALIDATION_PLUGIN ( - help, - workflow_command, - pre_help_text, - post_help_text, + UTILS_NFSCHEMA_PLUGIN ( + workflow, validate_params, - "nextflow_schema.json" + null ) + // // Check config provided to the pipeline @@ -80,8 +72,9 @@ workflow PIPELINE_INITIALISATION { // // Create channel from input file provided through params.input // + Channel - .fromSamplesheet("input") + .fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_input.json")) .map { meta, fastq_1, fastq_2 -> if (!fastq_2) { @@ -91,8 +84,8 @@ workflow PIPELINE_INITIALISATION { } } .groupTuple() - .map { - validateInputSamplesheet(it) + .map { samplesheet -> + validateInputSamplesheet(samplesheet) } .map { meta, fastqs -> @@ -117,13 +110,13 @@ workflow PIPELINE_COMPLETION { email // string: email address email_on_fail // string: email address sent on pipeline failure plaintext_email // boolean: Send plain-text email instead of HTML + outdir // path: Path to output directory where results will be published monochrome_logs // boolean: Disable ANSI colour codes in log output hook_url // string: hook URL for notifications multiqc_report // string: Path to MultiQC report main: - summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") // @@ -131,11 +124,18 @@ workflow PIPELINE_COMPLETION { // workflow.onComplete { if (email || email_on_fail) { - completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs, multiqc_report.toList()) + completionEmail( + summary_params, + email, + email_on_fail, + plaintext_email, + outdir, + monochrome_logs, + multiqc_report.toList() + ) } completionSummary(monochrome_logs) - if (hook_url) { imNotification(summary_params, hook_url) } @@ -165,7 +165,7 @@ def validateInputSamplesheet(input) { def (metas, fastqs) = input[1..2] // Check that multiple runs of the same sample are of the same datatype i.e. single-end / paired-end - def endedness_ok = metas.collect{ it.single_end }.unique().size == 1 + def endedness_ok = metas.collect{ meta -> meta.single_end }.unique().size == 1 if (!endedness_ok) { error("Please check input samplesheet -> Multiple runs of a sample must be of the same datatype i.e. single-end or paired-end: ${metas[0].id}") } @@ -197,7 +197,6 @@ def genomeExistsError() { error(error_string) } } - // // Generate methods description for MultiQC // @@ -239,8 +238,10 @@ def methodsDescriptionText(mqc_methods_yaml) { // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list def temp_doi_ref = "" - String[] manifest_doi = meta.manifest_map.doi.tokenize(",") - for (String doi_ref: manifest_doi) temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + def manifest_doi = meta.manifest_map.doi.tokenize(",") + manifest_doi.each { doi_ref -> + temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + } meta["doi_text"] = temp_doi_ref.substring(0, temp_doi_ref.length() - 2) } else meta["doi_text"] = "" meta["nodoi_text"] = meta.manifest_map.doi ? "" : "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " @@ -261,3 +262,4 @@ def methodsDescriptionText(mqc_methods_yaml) { return description_html.toString() } + diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index ac31f28f..28e32b20 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -2,10 +2,6 @@ // Subworkflow with functionality that may be useful for any Nextflow pipeline // -import org.yaml.snakeyaml.Yaml -import groovy.json.JsonOutput -import nextflow.extension.FilesEx - /* ======================================================================================== SUBWORKFLOW DEFINITION @@ -58,7 +54,7 @@ workflow UTILS_NEXTFLOW_PIPELINE { // Generate version string // def getWorkflowVersion() { - String version_string = "" + def version_string = "" as String if (workflow.manifest.version) { def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' version_string += "${prefix_v}${workflow.manifest.version}" @@ -79,10 +75,10 @@ def dumpParametersToJSON(outdir) { def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') def filename = "params_${timestamp}.json" def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = JsonOutput.toJson(params) - temp_pf.text = JsonOutput.prettyPrint(jsonStr) + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) - FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") + nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") temp_pf.delete() } @@ -90,7 +86,7 @@ def dumpParametersToJSON(outdir) { // When running with -profile conda, warn if channels have not been set-up appropriately // def checkCondaChannels() { - Yaml parser = new Yaml() + def parser = new org.yaml.snakeyaml.Yaml() def channels = [] try { def config = parser.load("conda config --show channels".execute().text) @@ -102,14 +98,16 @@ def checkCondaChannels() { // Check that all channels are present // This channel list is ordered by required channel priority. - def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] + def required_channels_in_order = ['conda-forge', 'bioconda'] def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order def channel_priority_violation = false - def n = required_channels_in_order.size() - for (int i = 0; i < n - 1; i++) { - channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) + + required_channels_in_order.eachWithIndex { channel, index -> + if (index < required_channels_in_order.size() - 1) { + channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index+1])) + } } if (channels_missing | channel_priority_violation) { diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config index d0a926bf..a09572e5 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config @@ -3,7 +3,7 @@ manifest { author = """nf-core""" homePage = 'https://127.0.0.1' description = """Dummy pipeline""" - nextflowVersion = '!>=23.04.0' + nextflowVersion = '!>=23.04.0' version = '9.9.9' doi = 'https://doi.org/10.5281/zenodo.5070524' } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index 14558c39..cbd8495b 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -2,9 +2,6 @@ // Subworkflow with utility functions specific to the nf-core pipeline template // -import org.yaml.snakeyaml.Yaml -import nextflow.extension.FilesEx - /* ======================================================================================== SUBWORKFLOW DEFINITION @@ -34,7 +31,7 @@ workflow UTILS_NFCORE_PIPELINE { // Warn if a -profile or Nextflow config has not been provided to run the pipeline // def checkConfigProvided() { - valid_config = true + def valid_config = true as Boolean if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + @@ -66,11 +63,13 @@ def checkProfileProvided(nextflow_cli_args) { // def workflowCitation() { def temp_doi_ref = "" - String[] manifest_doi = workflow.manifest.doi.tokenize(",") + def manifest_doi = workflow.manifest.doi.tokenize(",") // Using a loop to handle multiple DOIs // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list - for (String doi_ref: manifest_doi) temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" + manifest_doi.each { doi_ref -> + temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" + } return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + @@ -84,7 +83,7 @@ def workflowCitation() { // Generate workflow version string // def getWorkflowVersion() { - String version_string = "" + def version_string = "" as String if (workflow.manifest.version) { def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' version_string += "${prefix_v}${workflow.manifest.version}" @@ -102,8 +101,8 @@ def getWorkflowVersion() { // Get software versions for pipeline // def processVersionsFromYAML(yaml_file) { - Yaml yaml = new Yaml() - versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + def yaml = new org.yaml.snakeyaml.Yaml() + def versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } return yaml.dumpAsMap(versions).trim() } @@ -124,7 +123,7 @@ def workflowVersionToYAML() { def softwareVersionsToYAML(ch_versions) { return ch_versions .unique() - .map { processVersionsFromYAML(it) } + .map { version -> processVersionsFromYAML(version) } .unique() .mix(Channel.of(workflowVersionToYAML())) } @@ -134,19 +133,19 @@ def softwareVersionsToYAML(ch_versions) { // def paramsSummaryMultiqc(summary_params) { def summary_section = '' - for (group in summary_params.keySet()) { + summary_params.keySet().each { group -> def group_params = summary_params.get(group) // This gets the parameters of that particular group if (group_params) { summary_section += "

    $group

    \n" summary_section += "
    \n" - for (param in group_params.keySet()) { + group_params.keySet().sort().each { param -> summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" } summary_section += "
    \n" } } - String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" + def yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" as String yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" @@ -161,7 +160,7 @@ def paramsSummaryMultiqc(summary_params) { // nf-core logo // def nfCoreLogo(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map String.format( """\n ${dashedLine(monochrome_logs)} @@ -180,7 +179,7 @@ def nfCoreLogo(monochrome_logs=true) { // Return dashed line // def dashedLine(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map return "-${colors.dim}----------------------------------------------------${colors.reset}-" } @@ -188,7 +187,7 @@ def dashedLine(monochrome_logs=true) { // ANSII colours used for terminal logging // def logColours(monochrome_logs=true) { - Map colorcodes = [:] + def colorcodes = [:] as Map // Reset / Meta colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" @@ -287,7 +286,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi } def summary = [:] - for (group in summary_params.keySet()) { + summary_params.keySet().sort().each { group -> summary << summary_params[group] } @@ -344,10 +343,10 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi def sendmail_html = sendmail_template.toString() // Send the HTML e-mail - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map if (email_address) { try { - if (plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } + if (plaintext_email) { throw new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } // Try to send HTML e-mail using sendmail def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") sendmail_tf.withWriter { w -> w << sendmail_html } @@ -364,13 +363,13 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Write summary e-mail HTML to a file def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") output_hf.withWriter { w -> w << email_html } - FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); output_hf.delete() // Write summary e-mail TXT to a file def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") output_tf.withWriter { w -> w << email_txt } - FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); output_tf.delete() } @@ -378,7 +377,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Print pipeline summary on completion // def completionSummary(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map if (workflow.success) { if (workflow.stats.ignoredCount == 0) { log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" @@ -395,7 +394,7 @@ def completionSummary(monochrome_logs=true) { // def imNotification(summary_params, hook_url) { def summary = [:] - for (group in summary_params.keySet()) { + summary_params.keySet().sort().each { group -> summary << summary_params[group] } diff --git a/subworkflows/nf-core/utils_nfschema_plugin/main.nf b/subworkflows/nf-core/utils_nfschema_plugin/main.nf new file mode 100644 index 00000000..4994303e --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/main.nf @@ -0,0 +1,46 @@ +// +// Subworkflow that uses the nf-schema plugin to validate parameters and render the parameter summary +// + +include { paramsSummaryLog } from 'plugin/nf-schema' +include { validateParameters } from 'plugin/nf-schema' + +workflow UTILS_NFSCHEMA_PLUGIN { + + take: + input_workflow // workflow: the workflow object used by nf-schema to get metadata from the workflow + validate_params // boolean: validate the parameters + parameters_schema // string: path to the parameters JSON schema. + // this has to be the same as the schema given to `validation.parametersSchema` + // when this input is empty it will automatically use the configured schema or + // "${projectDir}/nextflow_schema.json" as default. This input should not be empty + // for meta pipelines + + main: + + // + // Print parameter summary to stdout. This will display the parameters + // that differ from the default given in the JSON schema + // + if(parameters_schema) { + log.info paramsSummaryLog(input_workflow, parameters_schema:parameters_schema) + } else { + log.info paramsSummaryLog(input_workflow) + } + + // + // Validate the parameters using nextflow_schema.json or the schema + // given via the validation.parametersSchema configuration option + // + if(validate_params) { + if(parameters_schema) { + validateParameters(parameters_schema:parameters_schema) + } else { + validateParameters() + } + } + + emit: + dummy_emit = true +} + diff --git a/subworkflows/nf-core/utils_nfschema_plugin/meta.yml b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml new file mode 100644 index 00000000..f7d9f028 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml @@ -0,0 +1,35 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "utils_nfschema_plugin" +description: Run nf-schema to validate parameters and create a summary of changed parameters +keywords: + - validation + - JSON schema + - plugin + - parameters + - summary +components: [] +input: + - input_workflow: + type: object + description: | + The workflow object of the used pipeline. + This object contains meta data used to create the params summary log + - validate_params: + type: boolean + description: Validate the parameters and error if invalid. + - parameters_schema: + type: string + description: | + Path to the parameters JSON schema. + This has to be the same as the schema given to the `validation.parametersSchema` config + option. When this input is empty it will automatically use the configured schema or + "${projectDir}/nextflow_schema.json" as default. The schema should not be given in this way + for meta pipelines. +output: + - dummy_emit: + type: boolean + description: Dummy emit to make nf-core subworkflows lint happy +authors: + - "@nvnieuwk" +maintainers: + - "@nvnieuwk" diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test new file mode 100644 index 00000000..842dc432 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test @@ -0,0 +1,117 @@ +nextflow_workflow { + + name "Test Subworkflow UTILS_NFSCHEMA_PLUGIN" + script "../main.nf" + workflow "UTILS_NFSCHEMA_PLUGIN" + + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/utils_nfschema_plugin" + tag "plugin/nf-schema" + + config "./nextflow.config" + + test("Should run nothing") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } + + test("Should run nothing - custom schema") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params - custom schema") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config new file mode 100644 index 00000000..0907ac58 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config @@ -0,0 +1,8 @@ +plugins { + id "nf-schema@2.1.0" +} + +validation { + parametersSchema = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + monochromeLogs = true +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json similarity index 95% rename from subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json rename to subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json index 7626c1c9..331e0d2f 100644 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json @@ -1,10 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", "title": ". pipeline parameters", "description": "", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", @@ -87,10 +87,10 @@ }, "allOf": [ { - "$ref": "#/definitions/input_output_options" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf b/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf deleted file mode 100644 index 2585b65d..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf +++ /dev/null @@ -1,62 +0,0 @@ -// -// Subworkflow that uses the nf-validation plugin to render help text and parameter summary -// - -/* -======================================================================================== - IMPORT NF-VALIDATION PLUGIN -======================================================================================== -*/ - -include { paramsHelp } from 'plugin/nf-validation' -include { paramsSummaryLog } from 'plugin/nf-validation' -include { validateParameters } from 'plugin/nf-validation' - -/* -======================================================================================== - SUBWORKFLOW DEFINITION -======================================================================================== -*/ - -workflow UTILS_NFVALIDATION_PLUGIN { - - take: - print_help // boolean: print help - workflow_command // string: default commmand used to run pipeline - pre_help_text // string: string to be printed before help text and summary log - post_help_text // string: string to be printed after help text and summary log - validate_params // boolean: validate parameters - schema_filename // path: JSON schema file, null to use default value - - main: - - log.debug "Using schema file: ${schema_filename}" - - // Default values for strings - pre_help_text = pre_help_text ?: '' - post_help_text = post_help_text ?: '' - workflow_command = workflow_command ?: '' - - // - // Print help message if needed - // - if (print_help) { - log.info pre_help_text + paramsHelp(workflow_command, parameters_schema: schema_filename) + post_help_text - System.exit(0) - } - - // - // Print parameter summary to stdout - // - log.info pre_help_text + paramsSummaryLog(workflow, parameters_schema: schema_filename) + post_help_text - - // - // Validate parameters relative to the parameter JSON schema - // - if (validate_params){ - validateParameters(parameters_schema: schema_filename) - } - - emit: - dummy_emit = true -} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml deleted file mode 100644 index 3d4a6b04..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml +++ /dev/null @@ -1,44 +0,0 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json -name: "UTILS_NFVALIDATION_PLUGIN" -description: Use nf-validation to initiate and validate a pipeline -keywords: - - utility - - pipeline - - initialise - - validation -components: [] -input: - - print_help: - type: boolean - description: | - Print help message and exit - - workflow_command: - type: string - description: | - The command to run the workflow e.g. "nextflow run main.nf" - - pre_help_text: - type: string - description: | - Text to print before the help message - - post_help_text: - type: string - description: | - Text to print after the help message - - validate_params: - type: boolean - description: | - Validate the parameters and error if invalid. - - schema_filename: - type: string - description: | - The filename of the schema to validate against. -output: - - dummy_emit: - type: boolean - description: | - Dummy emit to make nf-core subworkflows lint happy -authors: - - "@adamrtalbot" -maintainers: - - "@adamrtalbot" - - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test deleted file mode 100644 index 5784a33f..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test +++ /dev/null @@ -1,200 +0,0 @@ -nextflow_workflow { - - name "Test Workflow UTILS_NFVALIDATION_PLUGIN" - script "../main.nf" - workflow "UTILS_NFVALIDATION_PLUGIN" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "plugin/nf-validation" - tag "'plugin/nf-validation'" - tag "utils_nfvalidation_plugin" - tag "subworkflows/utils_nfvalidation_plugin" - - test("Should run nothing") { - - when { - - params { - monochrome_logs = true - test_data = '' - } - - workflow { - """ - help = false - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } - - test("Should run help") { - - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } } - ) - } - } - - test("Should run help with command") { - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = "nextflow run noorg/doesntexist" - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } } - ) - } - } - - test("Should run help with extra text") { - - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = "nextflow run noorg/doesntexist" - pre_help_text = "pre-help-text" - post_help_text = "post-help-text" - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('pre-help-text') } }, - { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } }, - { assert workflow.stdout.any { it.contains('post-help-text') } } - ) - } - } - - test("Should validate params") { - - when { - - params { - monochrome_logs = true - test_data = '' - outdir = 1 - } - workflow { - """ - help = false - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = true - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.failed }, - { assert workflow.stdout.any { it.contains('ERROR ~ ERROR: Validation of pipeline parameters failed!') } } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml deleted file mode 100644 index 60b1cfff..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/utils_nfvalidation_plugin: - - subworkflows/nf-core/utils_nfvalidation_plugin/** diff --git a/workflows/bacass.nf b/workflows/bacass.nf index eb5b309f..297525d1 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -3,10 +3,9 @@ IMPORT MODULES / SUBWORKFLOWS / FUNCTIONS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ - include { FASTQC } from '../modules/nf-core/fastqc/main' include { MULTIQC } from '../modules/nf-core/multiqc/main' -include { paramsSummaryMap } from 'plugin/nf-validation' +include { paramsSummaryMap } from 'plugin/nf-schema' include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_bacass_pipeline' @@ -21,12 +20,10 @@ workflow BACASS { take: ch_samplesheet // channel: samplesheet read in from --input - main: ch_versions = Channel.empty() ch_multiqc_files = Channel.empty() - // // MODULE: Run FastQC // @@ -42,11 +39,12 @@ workflow BACASS { softwareVersionsToYAML(ch_versions) .collectFile( storeDir: "${params.outdir}/pipeline_info", - name: 'nf_core_pipeline_software_mqc_versions.yml', + name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', sort: true, newLine: true ).set { ch_collated_versions } + // // MODULE: MultiQC // @@ -59,18 +57,19 @@ workflow BACASS { Channel.fromPath(params.multiqc_logo, checkIfExists: true) : Channel.empty() + summary_params = paramsSummaryMap( workflow, parameters_schema: "nextflow_schema.json") ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) - + ch_multiqc_files = ch_multiqc_files.mix( + ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) + ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) ch_methods_description = Channel.value( methodsDescriptionText(ch_multiqc_custom_methods_description)) - ch_multiqc_files = ch_multiqc_files.mix( - ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) ch_multiqc_files = ch_multiqc_files.mix(ch_collated_versions) ch_multiqc_files = ch_multiqc_files.mix( ch_methods_description.collectFile( @@ -83,12 +82,14 @@ workflow BACASS { ch_multiqc_files.collect(), ch_multiqc_config.toList(), ch_multiqc_custom_config.toList(), - ch_multiqc_logo.toList() + ch_multiqc_logo.toList(), + [], + [] ) - emit: - multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html + emit:multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html versions = ch_versions // channel: [ path(versions.yml) ] + } /* From 75ef2ec10269a562563635b41e9b44c61f8abe56 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Wed, 9 Oct 2024 11:01:33 +0000 Subject: [PATCH 42/70] Template update for nf-core/tools version 3.0.1 --- .editorconfig | 4 - .github/CONTRIBUTING.md | 2 +- .github/workflows/awsfulltest.yml | 6 +- .github/workflows/linting.yml | 4 +- .nf-core.yml | 2 +- .prettierignore | 1 - docs/output.md | 1 - modules.json | 6 +- modules/nf-core/multiqc/environment.yml | 2 +- modules/nf-core/multiqc/main.nf | 4 +- .../nf-core/multiqc/tests/main.nf.test.snap | 26 +- nextflow.config | 8 +- .../utils_nfcore_bacass_pipeline/main.nf | 12 +- .../nf-core/utils_nextflow_pipeline/main.nf | 46 ++- .../nf-core/utils_nfcore_pipeline/main.nf | 279 ++++++++++-------- 15 files changed, 209 insertions(+), 194 deletions(-) diff --git a/.editorconfig b/.editorconfig index e1058815..72dda289 100644 --- a/.editorconfig +++ b/.editorconfig @@ -11,7 +11,6 @@ indent_style = space [*.{md,yml,yaml,html,css,scss,js}] indent_size = 2 - # These files are edited and tested upstream in nf-core/modules [/modules/nf-core/**] charset = unset @@ -26,12 +25,9 @@ insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset - - [/assets/email*] indent_size = unset - # ignore python and markdown [*.{py,md}] indent_style = unset diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index 091001c9..07c8e1db 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -90,7 +90,7 @@ Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json ### Default processes resource requirements -Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/master/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. +Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/main/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. The process resources can be passed on to the tool dynamically within the process with the `${task.cpus}` and `${task.memory}` variables in the `script:` block. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index 60fbcf48..597d186b 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -14,16 +14,18 @@ on: jobs: run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/bacass' && github.event.review.state == 'approved' + # run only if the PR is approved by at least 2 reviewers and against the master branch or manually triggered + if: github.repository == 'nf-core/bacass' && github.event.review.state == 'approved' && github.event.pull_request.base.ref == 'master' || github.event_name == 'workflow_dispatch' runs-on: ubuntu-latest steps: - uses: octokit/request-action@v2.x id: check_approvals with: - route: GET /repos/${{ github.repository }}/pulls/${{ github.event.review.number }}/reviews + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews env: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} - id: test_variables + if: github.event_name != 'workflow_dispatch' run: | JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index b882838a..a502573c 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -42,10 +42,10 @@ jobs: architecture: "x64" - name: read .nf-core.yml - uses: pietrobolcato/action-read-yaml@1.0.0 + uses: pietrobolcato/action-read-yaml@1.1.0 id: read_yml with: - config: ${{ github.workspace }}/.nf-core.yaml + config: ${{ github.workspace }}/.nf-core.yml - name: Install dependencies run: | diff --git a/.nf-core.yml b/.nf-core.yml index 41499001..b4240862 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -5,7 +5,7 @@ lint: nextflow_config: - config_defaults: - params.dfast_config -nf_core_version: 3.0.0 +nf_core_version: 3.0.1 org_path: null repository_type: pipeline template: diff --git a/.prettierignore b/.prettierignore index 610e5069..437d763d 100644 --- a/.prettierignore +++ b/.prettierignore @@ -1,4 +1,3 @@ - email_template.html adaptivecard.json slackreport.json diff --git a/docs/output.md b/docs/output.md index 0feb2b19..58328ac6 100644 --- a/docs/output.md +++ b/docs/output.md @@ -14,7 +14,6 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d - [FastQC](#fastqc) - Raw read QC - [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline - - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution ### FastQC diff --git a/modules.json b/modules.json index dcbf6276..57aba295 100644 --- a/modules.json +++ b/modules.json @@ -12,7 +12,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "b8d36829fa84b6e404364abff787e8b07f6d058c", "installed_by": ["modules"] } } @@ -21,12 +21,12 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "d20fb2a9cc3e2835e9d067d1046a63252eb17352", + "git_sha": "9d05360da397692321d377b6102d2fb22507c6ef", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "2fdce49d30c0254f76bc0f13c55c17455c1251ab", + "git_sha": "772684d9d66f37b650c8ba5146ac1ee3ecba2acb", "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index f1cd99b0..6f5b867b 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -2,4 +2,4 @@ channels: - conda-forge - bioconda dependencies: - - bioconda::multiqc=1.24.1 + - bioconda::multiqc=1.25.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index b9ccebdb..9724d2f3 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,8 +3,8 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.25--pyhdfd78af_0' : - 'biocontainers/multiqc:1.25--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25.1--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25.1--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index b779e469..2fcbb5ff 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T12:41:34.562023" + "timestamp": "2024-10-02T17:51:46.317523" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T11:27:11.933869532" + "timestamp": "2024-10-02T17:52:20.680978" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,8c8724363a5efe0c6f43ab34faa57efd" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-07-10T11:26:56.709849369" + "timestamp": "2024-10-02T17:52:09.185842" } -} +} \ No newline at end of file diff --git a/nextflow.config b/nextflow.config index d2b37edb..85f547d7 100644 --- a/nextflow.config +++ b/nextflow.config @@ -12,10 +12,12 @@ params { // TODO nf-core: Specify your pipeline's command line flags // Input options input = null + // References genome = null igenomes_base = 's3://ngi-igenomes/igenomes/' igenomes_ignore = false + // MultiQC options multiqc_config = null multiqc_title = null @@ -36,6 +38,7 @@ params { show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' + // Config options config_profile_name = null config_profile_description = null @@ -44,9 +47,9 @@ params { custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" config_profile_contact = null config_profile_url = null + // Schema validation default options validate_params = true - } // Load base.config by default for all pipelines @@ -161,6 +164,7 @@ includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${pa // Load nf-core/bacass custom profiles from different institutions. // TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs // includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/bacass.config" : "/dev/null" + // Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile // Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled // Set to your registry if you have a mirror of containers @@ -172,6 +176,7 @@ charliecloud.registry = 'quay.io' // Load igenomes.config if required includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' + // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. // See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. @@ -263,4 +268,3 @@ validation { // Load modules.config for DSL2 module specific options includeConfig 'conf/modules.config' - diff --git a/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf b/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf index 68dab7db..9d079a67 100644 --- a/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf @@ -18,9 +18,9 @@ include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW TO INITIALISE PIPELINE -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow PIPELINE_INITIALISATION { @@ -99,9 +99,9 @@ workflow PIPELINE_INITIALISATION { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW FOR PIPELINE COMPLETION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow PIPELINE_COMPLETION { @@ -147,9 +147,9 @@ workflow PIPELINE_COMPLETION { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // // Check and validate pipeline parameters diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index 28e32b20..2b0dc67a 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -3,13 +3,12 @@ // /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NEXTFLOW_PIPELINE { - take: print_version // boolean: print version dump_parameters // boolean: dump parameters @@ -22,7 +21,7 @@ workflow UTILS_NEXTFLOW_PIPELINE { // Print workflow version and exit on --version // if (print_version) { - log.info "${workflow.manifest.name} ${getWorkflowVersion()}" + log.info("${workflow.manifest.name} ${getWorkflowVersion()}") System.exit(0) } @@ -45,9 +44,9 @@ workflow UTILS_NEXTFLOW_PIPELINE { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -72,11 +71,11 @@ def getWorkflowVersion() { // Dump pipeline parameters to a JSON file // def dumpParametersToJSON(outdir) { - def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') - def filename = "params_${timestamp}.json" - def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = groovy.json.JsonOutput.toJson(params) - temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) + def timestamp = new java.util.Date().format('yyyy-MM-dd_HH-mm-ss') + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") temp_pf.delete() @@ -91,9 +90,14 @@ def checkCondaChannels() { try { def config = parser.load("conda config --show channels".execute().text) channels = config.channels - } catch(NullPointerException | IOException e) { - log.warn "Could not verify conda channel configuration." - return + } + catch (NullPointerException e) { + log.warn("Could not verify conda channel configuration.") + return null + } + catch (IOException e) { + log.warn("Could not verify conda channel configuration.") + return null } // Check that all channels are present @@ -106,19 +110,13 @@ def checkCondaChannels() { required_channels_in_order.eachWithIndex { channel, index -> if (index < required_channels_in_order.size() - 1) { - channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index+1])) + channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index + 1])) } } if (channels_missing | channel_priority_violation) { - log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " There is a problem with your Conda configuration!\n\n" + - " You will need to set-up the conda-forge and bioconda channels correctly.\n" + - " Please refer to https://bioconda.github.io/\n" + - " The observed channel order is \n" + - " ${channels}\n" + - " but the following channel order is required:\n" + - " ${required_channels_in_order}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + log.warn( + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + " There is a problem with your Conda configuration!\n\n" + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + " Please refer to https://bioconda.github.io/\n" + " The observed channel order is \n" + " ${channels}\n" + " but the following channel order is required:\n" + " ${required_channels_in_order}\n" + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + ) } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index cbd8495b..b78273ca 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -3,13 +3,12 @@ // /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NFCORE_PIPELINE { - take: nextflow_cli_args @@ -22,9 +21,9 @@ workflow UTILS_NFCORE_PIPELINE { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -33,12 +32,9 @@ workflow UTILS_NFCORE_PIPELINE { def checkConfigProvided() { def valid_config = true as Boolean if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { - log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + - "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + - " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + - " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + - " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + - "Please refer to the quick start section and usage docs for the pipeline.\n " + log.warn( + "[${workflow.manifest.name}] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + "Please refer to the quick start section and usage docs for the pipeline.\n " + ) valid_config = false } return valid_config @@ -49,12 +45,14 @@ def checkConfigProvided() { // def checkProfileProvided(nextflow_cli_args) { if (workflow.profile.endsWith(',')) { - error "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + - "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + error( + "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) } if (nextflow_cli_args[0]) { - log.warn "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + - "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + log.warn( + "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) } } @@ -70,13 +68,7 @@ def workflowCitation() { manifest_doi.each { doi_ref -> temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" } - return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + - "* The pipeline\n" + - temp_doi_ref + "\n" + - "* The nf-core framework\n" + - " https://doi.org/10.1038/s41587-020-0439-x\n\n" + - "* Software dependencies\n" + - " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" + return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + "* The nf-core framework\n" + " https://doi.org/10.1038/s41587-020-0439-x\n\n" + "* Software dependencies\n" + " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" } // @@ -102,7 +94,7 @@ def getWorkflowVersion() { // def processVersionsFromYAML(yaml_file) { def yaml = new org.yaml.snakeyaml.Yaml() - def versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + def versions = yaml.load(yaml_file).collectEntries { k, v -> [k.tokenize(':')[-1], v] } return yaml.dumpAsMap(versions).trim() } @@ -112,8 +104,8 @@ def processVersionsFromYAML(yaml_file) { def workflowVersionToYAML() { return """ Workflow: - $workflow.manifest.name: ${getWorkflowVersion()} - Nextflow: $workflow.nextflow.version + ${workflow.manifest.name}: ${getWorkflowVersion()} + Nextflow: ${workflow.nextflow.version} """.stripIndent().trim() } @@ -121,11 +113,7 @@ def workflowVersionToYAML() { // Get channel of software versions used in pipeline in YAML format // def softwareVersionsToYAML(ch_versions) { - return ch_versions - .unique() - .map { version -> processVersionsFromYAML(version) } - .unique() - .mix(Channel.of(workflowVersionToYAML())) + return ch_versions.unique().map { version -> processVersionsFromYAML(version) }.unique().mix(Channel.of(workflowVersionToYAML())) } // @@ -133,25 +121,31 @@ def softwareVersionsToYAML(ch_versions) { // def paramsSummaryMultiqc(summary_params) { def summary_section = '' - summary_params.keySet().each { group -> - def group_params = summary_params.get(group) // This gets the parameters of that particular group - if (group_params) { - summary_section += "

    $group

    \n" - summary_section += "
    \n" - group_params.keySet().sort().each { param -> - summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" + summary_params + .keySet() + .each { group -> + def group_params = summary_params.get(group) + // This gets the parameters of that particular group + if (group_params) { + summary_section += "

    ${group}

    \n" + summary_section += "
    \n" + group_params + .keySet() + .sort() + .each { param -> + summary_section += "
    ${param}
    ${group_params.get(param) ?: 'N/A'}
    \n" + } + summary_section += "
    \n" } - summary_section += "
    \n" } - } - def yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" as String - yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" - yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" - yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" - yaml_file_text += "plot_type: 'html'\n" - yaml_file_text += "data: |\n" - yaml_file_text += "${summary_section}" + def yaml_file_text = "id: '${workflow.manifest.name.replace('/', '-')}-summary'\n" as String + yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" + yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" + yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" + yaml_file_text += "plot_type: 'html'\n" + yaml_file_text += "data: |\n" + yaml_file_text += "${summary_section}" return yaml_file_text } @@ -199,54 +193,54 @@ def logColours(monochrome_logs=true) { colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" // Regular Colors - colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" - colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" - colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" - colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" - colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" - colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" - colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" - colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" + colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" + colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" + colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" + colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" + colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" + colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" + colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" + colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" // Bold - colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" - colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" - colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" - colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" - colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" - colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" - colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" - colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" + colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" + colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" + colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" + colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" + colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" + colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" + colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" + colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" // Underline - colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" - colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" - colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" - colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" - colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" - colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" - colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" - colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" + colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" + colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" + colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" + colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" + colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" + colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" + colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" + colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" // High Intensity - colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" - colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" - colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" - colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" - colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" - colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" - colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" - colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" + colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" + colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" + colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" + colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" + colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" + colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" + colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" + colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" // Bold High Intensity - colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" - colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" - colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" - colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" - colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" - colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" - colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" - colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" + colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" + colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" + colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" + colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" + colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" + colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" + colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" + colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" return colorcodes } @@ -261,14 +255,15 @@ def attachMultiqcReport(multiqc_report) { mqc_report = multiqc_report.getVal() if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { if (mqc_report.size() > 1) { - log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" + log.warn("[${workflow.manifest.name}] Found multiple reports from process 'MULTIQC', will use only one") } mqc_report = mqc_report[0] } } - } catch (all) { + } + catch (Exception all) { if (multiqc_report) { - log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" + log.warn("[${workflow.manifest.name}] Could not attach MultiQC report to summary email") } } return mqc_report @@ -280,26 +275,35 @@ def attachMultiqcReport(multiqc_report) { def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs=true, multiqc_report=null) { // Set up the e-mail variables - def subject = "[$workflow.manifest.name] Successful: $workflow.runName" + def subject = "[${workflow.manifest.name}] Successful: ${workflow.runName}" if (!workflow.success) { - subject = "[$workflow.manifest.name] FAILED: $workflow.runName" + subject = "[${workflow.manifest.name}] FAILED: ${workflow.runName}" } def summary = [:] - summary_params.keySet().sort().each { group -> - summary << summary_params[group] - } + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } def misc_fields = [:] misc_fields['Date Started'] = workflow.start misc_fields['Date Completed'] = workflow.complete misc_fields['Pipeline script file path'] = workflow.scriptFile misc_fields['Pipeline script hash ID'] = workflow.scriptId - if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository - if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId - if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision - misc_fields['Nextflow Version'] = workflow.nextflow.version - misc_fields['Nextflow Build'] = workflow.nextflow.build + if (workflow.repository) { + misc_fields['Pipeline repository Git URL'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['Pipeline repository Git Commit'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['Pipeline Git branch/tag'] = workflow.revision + } + misc_fields['Nextflow Version'] = workflow.nextflow.version + misc_fields['Nextflow Build'] = workflow.nextflow.build misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp def email_fields = [:] @@ -337,7 +341,7 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Render the sendmail template def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit - def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] + def smail_fields = [email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes()] def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") def sendmail_template = engine.createTemplate(sf).make(smail_fields) def sendmail_html = sendmail_template.toString() @@ -346,30 +350,32 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi def colors = logColours(monochrome_logs) as Map if (email_address) { try { - if (plaintext_email) { throw new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } + if (plaintext_email) { +new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } // Try to send HTML e-mail using sendmail def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") sendmail_tf.withWriter { w -> w << sendmail_html } - [ 'sendmail', '-t' ].execute() << sendmail_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" - } catch (all) { + ['sendmail', '-t'].execute() << sendmail_html + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (sendmail)-") + } + catch (Exception all) { // Catch failures and try with plaintext - def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] + def mail_cmd = ['mail', '-s', subject, '--content-type=text/html', email_address] mail_cmd.execute() << email_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (mail)-") } } // Write summary e-mail HTML to a file def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") output_hf.withWriter { w -> w << email_html } - nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html") output_hf.delete() // Write summary e-mail TXT to a file def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") output_tf.withWriter { w -> w << email_txt } - nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt") output_tf.delete() } @@ -380,12 +386,14 @@ def completionSummary(monochrome_logs=true) { def colors = logColours(monochrome_logs) as Map if (workflow.success) { if (workflow.stats.ignoredCount == 0) { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Pipeline completed successfully${colors.reset}-") + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-") } - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.red} Pipeline completed with errors${colors.reset}-") } } @@ -394,21 +402,30 @@ def completionSummary(monochrome_logs=true) { // def imNotification(summary_params, hook_url) { def summary = [:] - summary_params.keySet().sort().each { group -> - summary << summary_params[group] - } + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } def misc_fields = [:] - misc_fields['start'] = workflow.start - misc_fields['complete'] = workflow.complete - misc_fields['scriptfile'] = workflow.scriptFile - misc_fields['scriptid'] = workflow.scriptId - if (workflow.repository) misc_fields['repository'] = workflow.repository - if (workflow.commitId) misc_fields['commitid'] = workflow.commitId - if (workflow.revision) misc_fields['revision'] = workflow.revision - misc_fields['nxf_version'] = workflow.nextflow.version - misc_fields['nxf_build'] = workflow.nextflow.build - misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp + misc_fields['start'] = workflow.start + misc_fields['complete'] = workflow.complete + misc_fields['scriptfile'] = workflow.scriptFile + misc_fields['scriptid'] = workflow.scriptId + if (workflow.repository) { + misc_fields['repository'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['commitid'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['revision'] = workflow.revision + } + misc_fields['nxf_version'] = workflow.nextflow.version + misc_fields['nxf_build'] = workflow.nextflow.build + misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp def msg_fields = [:] msg_fields['version'] = getWorkflowVersion() @@ -433,13 +450,13 @@ def imNotification(summary_params, hook_url) { def json_message = json_template.toString() // POST - def post = new URL(hook_url).openConnection(); + def post = new URL(hook_url).openConnection() post.setRequestMethod("POST") post.setDoOutput(true) post.setRequestProperty("Content-Type", "application/json") - post.getOutputStream().write(json_message.getBytes("UTF-8")); - def postRC = post.getResponseCode(); - if (! postRC.equals(200)) { - log.warn(post.getErrorStream().getText()); + post.getOutputStream().write(json_message.getBytes("UTF-8")) + def postRC = post.getResponseCode() + if (!postRC.equals(200)) { + log.warn(post.getErrorStream().getText()) } } From 4a10f2ad990faa4e694649640dcbcdd849490897 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Fri, 11 Oct 2024 12:28:32 +0000 Subject: [PATCH 43/70] Template update for nf-core/tools version 3.0.2 --- .github/workflows/ci.yml | 60 +++++++++++++------ .../workflows/template_version_comment.yml | 21 ++++--- .gitignore | 1 + .nf-core.yml | 2 +- main.nf | 2 +- modules.json | 6 +- modules/nf-core/multiqc/main.nf | 2 +- nextflow.config | 4 +- .../utils_nfcore_bacass_pipeline/main.nf | 4 +- .../nf-core/utils_nextflow_pipeline/main.nf | 30 +++++----- .../nf-core/utils_nfcore_pipeline/main.nf | 10 ++-- workflows/bacass.nf | 2 - 12 files changed, 86 insertions(+), 58 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index a1eda2e0..e1a51cd0 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -11,6 +11,8 @@ on: env: NXF_ANSI_LOG: false + NXF_SINGULARITY_CACHEDIR: ${{ github.workspace }}/.singularity + NXF_SINGULARITY_LIBRARYDIR: ${{ github.workspace }}/.singularity concurrency: group: "${{ github.workflow }}-${{ github.event.pull_request.number || github.ref }}" @@ -18,7 +20,7 @@ concurrency: jobs: test: - name: Run pipeline with test data + name: "Run pipeline with test data (${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }})" # Only run on push if this is the nf-core dev branch (merged PRs) if: "${{ github.event_name != 'push' || (github.event_name == 'push' && github.repository == 'nf-core/bacass') }}" runs-on: ubuntu-latest @@ -27,33 +29,57 @@ jobs: NXF_VER: - "24.04.2" - "latest-everything" + profile: + - "conda" + - "docker" + - "singularity" + test_name: + - "test" + isMaster: + - ${{ github.base_ref == 'master' }} + # Exclude conda and singularity on dev + exclude: + - isMaster: false + profile: "conda" + - isMaster: false + profile: "singularity" steps: - name: Check out pipeline code uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 - - name: Install Nextflow + - name: Set up Nextflow uses: nf-core/setup-nextflow@v2 with: version: "${{ matrix.NXF_VER }}" - - name: Disk space cleanup - uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 + - name: Set up Apptainer + if: matrix.profile == 'singularity' + uses: eWaterCycle/setup-apptainer@main - - name: Run pipeline with test data (docker) - # TODO nf-core: You can customise CI pipeline run tests as required - # For example: adding multiple test runs with different parameters - # Remember that you can parallelise this by using strategy.matrix + - name: Set up Singularity + if: matrix.profile == 'singularity' run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker --outdir ./results + mkdir -p $NXF_SINGULARITY_CACHEDIR + mkdir -p $NXF_SINGULARITY_LIBRARYDIR + + - name: Set up Miniconda + if: matrix.profile == 'conda' + uses: conda-incubator/setup-miniconda@a4260408e20b96e80095f42ff7f1a15b27dd94ca # v3 + with: + miniconda-version: "latest" + auto-update-conda: true + conda-solver: libmamba + channels: conda-forge,bioconda - - name: Run pipeline with test data (singularity) - # TODO nf-core: You can customise CI pipeline run tests as required + - name: Set up Conda + if: matrix.profile == 'conda' run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,singularity --outdir ./results - if: "${{ github.base_ref == 'master' }}" + echo $(realpath $CONDA)/condabin >> $GITHUB_PATH + echo $(realpath python) >> $GITHUB_PATH + + - name: Clean up Disk space + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - name: Run pipeline with test data (conda) - # TODO nf-core: You can customise CI pipeline run tests as required + - name: "Run pipeline with test data ${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }}" run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,conda --outdir ./results - if: "${{ github.base_ref == 'master' }}" + nextflow run ${GITHUB_WORKSPACE} -profile ${{ matrix.test_name }},${{ matrix.profile }} --outdir ./results diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml index 9dea41f0..e8aafe44 100644 --- a/.github/workflows/template_version_comment.yml +++ b/.github/workflows/template_version_comment.yml @@ -10,9 +10,11 @@ jobs: steps: - name: Check out pipeline code uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + with: + ref: ${{ github.event.pull_request.head.sha }} - name: Read template version from .nf-core.yml - uses: pietrobolcato/action-read-yaml@1.0.0 + uses: nichmor/minimal-read-yaml@v0.0.2 id: read_yml with: config: ${{ github.workspace }}/.nf-core.yml @@ -24,20 +26,21 @@ jobs: - name: Check nf-core outdated id: nf_core_outdated - run: pip list --outdated | grep nf-core + run: echo "OUTPUT=$(pip list --outdated | grep nf-core)" >> ${GITHUB_ENV} - name: Post nf-core template version comment uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 if: | - ${{ steps.nf_core_outdated.outputs.stdout }} =~ 'nf-core' + contains(env.OUTPUT, 'nf-core') with: repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} allow-repeats: false message: | - ## :warning: Newer version of the nf-core template is available. - - Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. - Please update your pipeline to the latest version. - - For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + > [!WARNING] + > Newer version of the nf-core template is available. + > + > Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + > Please update your pipeline to the latest version. + > + > For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). # diff --git a/.gitignore b/.gitignore index 5124c9ac..a42ce016 100644 --- a/.gitignore +++ b/.gitignore @@ -6,3 +6,4 @@ results/ testing/ testing* *.pyc +null/ diff --git a/.nf-core.yml b/.nf-core.yml index b4240862..b089730b 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -5,7 +5,7 @@ lint: nextflow_config: - config_defaults: - params.dfast_config -nf_core_version: 3.0.1 +nf_core_version: 3.0.2 org_path: null repository_type: pipeline template: diff --git a/main.nf b/main.nf index 6402f62e..8f1827ab 100644 --- a/main.nf +++ b/main.nf @@ -76,7 +76,7 @@ workflow { params.outdir, params.input ) - + // // WORKFLOW: Run main workflow // diff --git a/modules.json b/modules.json index 57aba295..387c0eda 100644 --- a/modules.json +++ b/modules.json @@ -12,7 +12,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "b8d36829fa84b6e404364abff787e8b07f6d058c", + "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", "installed_by": ["modules"] } } @@ -21,12 +21,12 @@ "nf-core": { "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "9d05360da397692321d377b6102d2fb22507c6ef", + "git_sha": "3aa0aec1d52d492fe241919f0c6100ebf0074082", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "772684d9d66f37b650c8ba5146ac1ee3ecba2acb", + "git_sha": "1b6b9a3338d011367137808b49b923515080e3ba", "installed_by": ["subworkflows"] }, "utils_nfschema_plugin": { diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 9724d2f3..cc0643e1 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -52,7 +52,7 @@ process MULTIQC { stub: """ mkdir multiqc_data - touch multiqc_plots + mkdir multiqc_plots touch multiqc_report.html cat <<-END_VERSIONS > versions.yml diff --git a/nextflow.config b/nextflow.config index 85f547d7..5bb8caa1 100644 --- a/nextflow.config +++ b/nextflow.config @@ -254,10 +254,10 @@ validation { """ afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} * The nf-core framework - https://doi.org/10.1038/s41587-020-0439-x + https://doi.org/10.1038/s41587-020-0439-x * Software dependencies - https://github.com/${manifest.name}/blob/master/CITATIONS.md + https://github.com/${manifest.name}/blob/master/CITATIONS.md """ } summary { diff --git a/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf b/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf index 9d079a67..c3d50d26 100644 --- a/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf @@ -47,7 +47,6 @@ workflow PIPELINE_INITIALISATION { workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 ) - // // Validate parameters and generate parameter summary to stdout // @@ -56,7 +55,6 @@ workflow PIPELINE_INITIALISATION { validate_params, null ) - // // Check config provided to the pipeline @@ -64,6 +62,7 @@ workflow PIPELINE_INITIALISATION { UTILS_NFCORE_PIPELINE ( nextflow_cli_args ) + // // Custom validation for pipeline parameters // @@ -110,7 +109,6 @@ workflow PIPELINE_COMPLETION { email // string: email address email_on_fail // string: email address sent on pipeline failure plaintext_email // boolean: Send plain-text email instead of HTML - outdir // path: Path to output directory where results will be published monochrome_logs // boolean: Disable ANSI colour codes in log output hook_url // string: hook URL for notifications diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index 2b0dc67a..0fcbf7b3 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -3,9 +3,9 @@ // /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NEXTFLOW_PIPELINE { @@ -44,9 +44,9 @@ workflow UTILS_NEXTFLOW_PIPELINE { } /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -106,17 +106,19 @@ def checkCondaChannels() { def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order - def channel_priority_violation = false - - required_channels_in_order.eachWithIndex { channel, index -> - if (index < required_channels_in_order.size() - 1) { - channel_priority_violation |= !(channels.indexOf(channel) < channels.indexOf(required_channels_in_order[index + 1])) - } - } + def channel_priority_violation = required_channels_in_order != channels.findAll { ch -> ch in required_channels_in_order } if (channels_missing | channel_priority_violation) { - log.warn( - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + " There is a problem with your Conda configuration!\n\n" + " You will need to set-up the conda-forge and bioconda channels correctly.\n" + " Please refer to https://bioconda.github.io/\n" + " The observed channel order is \n" + " ${channels}\n" + " but the following channel order is required:\n" + " ${required_channels_in_order}\n" + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - ) + log.warn """\ + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + There is a problem with your Conda configuration! + You will need to set-up the conda-forge and bioconda channels correctly. + Please refer to https://bioconda.github.io/ + The observed channel order is + ${channels} + but the following channel order is required: + ${required_channels_in_order} + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + """.stripIndent(true) } } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index b78273ca..5cb7bafe 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -3,9 +3,9 @@ // /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NFCORE_PIPELINE { @@ -21,9 +21,9 @@ workflow UTILS_NFCORE_PIPELINE { } /* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // @@ -62,7 +62,7 @@ def checkProfileProvided(nextflow_cli_args) { def workflowCitation() { def temp_doi_ref = "" def manifest_doi = workflow.manifest.doi.tokenize(",") - // Using a loop to handle multiple DOIs + // Handling multiple DOIs // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list manifest_doi.each { doi_ref -> diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 297525d1..d42bdebb 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -57,13 +57,11 @@ workflow BACASS { Channel.fromPath(params.multiqc_logo, checkIfExists: true) : Channel.empty() - summary_params = paramsSummaryMap( workflow, parameters_schema: "nextflow_schema.json") ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) ch_multiqc_files = ch_multiqc_files.mix( ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) - ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) From efbade0b9e96a24d1446376bec880f922180aab9 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 11 Oct 2024 16:34:53 +0200 Subject: [PATCH 44/70] mv fastp to older version due to inconsistency with fastq_trim_fastp_fastqc subworkflow --- modules.json | 8 +- modules/nf-core/fastp/environment.yml | 2 + modules/nf-core/fastp/main.nf | 21 +- modules/nf-core/fastp/meta.yml | 134 +- modules/nf-core/fastp/tests/main.nf.test | 823 ++++++---- modules/nf-core/fastp/tests/main.nf.test.snap | 1361 +++-------------- modules/nf-core/fastqc/environment.yml | 2 + modules/nf-core/fastqc/main.nf | 9 - modules/nf-core/fastqc/meta.yml | 57 +- modules/nf-core/fastqc/tests/main.nf.test | 225 +-- .../nf-core/fastqc/tests/main.nf.test.snap | 370 +---- .../nf-core/fastq_trim_fastp_fastqc/main.nf | 1 - .../nf-core/fastq_trim_fastp_fastqc/meta.yml | 2 +- 13 files changed, 852 insertions(+), 2163 deletions(-) diff --git a/modules.json b/modules.json index 0facb653..ba06f0ab 100644 --- a/modules.json +++ b/modules.json @@ -28,12 +28,12 @@ }, "fastp": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["fastq_trim_fastp_fastqc"] + "git_sha": "95cf5fe0194c7bf5cb0e3027a2eb7e7c89385080", + "installed_by": ["fastq_trim_fastp_fastqc", "modules"] }, "fastqc": { "branch": "master", - "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "git_sha": "95cf5fe0194c7bf5cb0e3027a2eb7e7c89385080", "installed_by": ["fastq_trim_fastp_fastqc"] }, "gunzip": { @@ -113,7 +113,7 @@ "nf-core": { "fastq_trim_fastp_fastqc": { "branch": "master", - "git_sha": "e743b2dea725bcfc4b76a209981808987332013a", + "git_sha": "95cf5fe0194c7bf5cb0e3027a2eb7e7c89385080", "installed_by": ["subworkflows"] }, "utils_nextflow_pipeline": { diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/fastp/environment.yml index 26d4aca5..70389e66 100644 --- a/modules/nf-core/fastp/environment.yml +++ b/modules/nf-core/fastp/environment.yml @@ -1,5 +1,7 @@ +name: fastp channels: - conda-forge - bioconda + - defaults dependencies: - bioconda::fastp=0.23.4 diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index e1b9f565..4fc19b74 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -10,7 +10,6 @@ process FASTP { input: tuple val(meta), path(reads) path adapter_fasta - val discard_trimmed_pass val save_trimmed_fail val save_merged @@ -19,9 +18,9 @@ process FASTP { tuple val(meta), path('*.json') , emit: json tuple val(meta), path('*.html') , emit: html tuple val(meta), path('*.log') , emit: log + path "versions.yml" , emit: versions tuple val(meta), path('*.fail.fastq.gz') , optional:true, emit: reads_fail tuple val(meta), path('*.merged.fastq.gz'), optional:true, emit: reads_merged - path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -31,8 +30,6 @@ process FASTP { def prefix = task.ext.prefix ?: "${meta.id}" def adapter_list = adapter_fasta ? "--adapter_fasta ${adapter_fasta}" : "" def fail_fastq = save_trimmed_fail && meta.single_end ? "--failed_out ${prefix}.fail.fastq.gz" : save_trimmed_fail && !meta.single_end ? "--failed_out ${prefix}.paired.fail.fastq.gz --unpaired1 ${prefix}_1.fail.fastq.gz --unpaired2 ${prefix}_2.fail.fastq.gz" : '' - def out_fq1 = discard_trimmed_pass ?: ( meta.single_end ? "--out1 ${prefix}.fastp.fastq.gz" : "--out1 ${prefix}_1.fastp.fastq.gz" ) - def out_fq2 = discard_trimmed_pass ?: "--out2 ${prefix}_2.fastp.fastq.gz" // Added soft-links to original fastqs for consistent naming in MultiQC // Use single ended for interleaved. Add --interleaved_in in config. if ( task.ext.args?.contains('--interleaved_in') ) { @@ -62,7 +59,7 @@ process FASTP { fastp \\ --in1 ${prefix}.fastq.gz \\ - $out_fq1 \\ + --out1 ${prefix}.fastp.fastq.gz \\ --thread $task.cpus \\ --json ${prefix}.fastp.json \\ --html ${prefix}.fastp.html \\ @@ -84,8 +81,8 @@ process FASTP { fastp \\ --in1 ${prefix}_1.fastq.gz \\ --in2 ${prefix}_2.fastq.gz \\ - $out_fq1 \\ - $out_fq2 \\ + --out1 ${prefix}_1.fastp.fastq.gz \\ + --out2 ${prefix}_2.fastp.fastq.gz \\ --json ${prefix}.fastp.json \\ --html ${prefix}.fastp.html \\ $adapter_list \\ @@ -106,16 +103,14 @@ process FASTP { stub: def prefix = task.ext.prefix ?: "${meta.id}" def is_single_output = task.ext.args?.contains('--interleaved_in') || meta.single_end - def touch_reads = (discard_trimmed_pass) ? "" : (is_single_output) ? "echo '' | gzip > ${prefix}.fastp.fastq.gz" : "echo '' | gzip > ${prefix}_1.fastp.fastq.gz ; echo '' | gzip > ${prefix}_2.fastp.fastq.gz" - def touch_merged = (!is_single_output && save_merged) ? "echo '' | gzip > ${prefix}.merged.fastq.gz" : "" - def touch_fail_fastq = (!save_trimmed_fail) ? "" : meta.single_end ? "echo '' | gzip > ${prefix}.fail.fastq.gz" : "echo '' | gzip > ${prefix}.paired.fail.fastq.gz ; echo '' | gzip > ${prefix}_1.fail.fastq.gz ; echo '' | gzip > ${prefix}_2.fail.fastq.gz" + def touch_reads = is_single_output ? "${prefix}.fastp.fastq.gz" : "${prefix}_1.fastp.fastq.gz ${prefix}_2.fastp.fastq.gz" + def touch_merged = (!is_single_output && save_merged) ? "touch ${prefix}.merged.fastq.gz" : "" """ - $touch_reads - $touch_fail_fastq - $touch_merged + touch $touch_reads touch "${prefix}.fastp.json" touch "${prefix}.fastp.html" touch "${prefix}.fastp.log" + $touch_merged cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml index 159404d0..c22a16ab 100644 --- a/modules/nf-core/fastp/meta.yml +++ b/modules/nf-core/fastp/meta.yml @@ -11,100 +11,62 @@ tools: documentation: https://github.com/OpenGene/fastp doi: 10.1093/bioinformatics/bty560 licence: ["MIT"] - identifier: biotools:fastp input: - - - meta: - type: map - description: | - Groovy Map containing sample information. Use 'single_end: true' to specify single ended or interleaved FASTQs. Use 'single_end: false' for paired-end reads. - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. If you wish to run interleaved paired-end data, supply as single-end data - but with `--interleaved_in` in your `modules.conf`'s `ext.args` for the module. - - - adapter_fasta: - type: file - description: File in FASTA format containing possible adapters to remove. - pattern: "*.{fasta,fna,fas,fa}" - - - discard_trimmed_pass: - type: boolean - description: Specify true to not write any reads that pass trimming thresholds. - | This can be used to use fastp for the output report only. - - - save_trimmed_fail: - type: boolean - description: Specify true to save files that failed to pass trimming thresholds - ending in `*.fail.fastq.gz` - - - save_merged: - type: boolean - description: Specify true to save all merged reads to a file ending in `*.merged.fastq.gz` + - meta: + type: map + description: | + Groovy Map containing sample information. Use 'single_end: true' to specify single ended or interleaved FASTQs. Use 'single_end: false' for paired-end reads. + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. If you wish to run interleaved paired-end data, supply as single-end data + but with `--interleaved_in` in your `modules.conf`'s `ext.args` for the module. + - adapter_fasta: + type: file + description: File in FASTA format containing possible adapters to remove. + pattern: "*.{fasta,fna,fas,fa}" + - save_trimmed_fail: + type: boolean + description: Specify true to save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz` + - save_merged: + type: boolean + description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz` output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - reads: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.fastp.fastq.gz": - type: file - description: The trimmed/modified/unmerged fastq reads - pattern: "*fastp.fastq.gz" + type: file + description: The trimmed/modified/unmerged fastq reads + pattern: "*fastp.fastq.gz" - json: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.json": - type: file - description: Results in JSON format - pattern: "*.json" + type: file + description: Results in JSON format + pattern: "*.json" - html: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.html": - type: file - description: Results in HTML format - pattern: "*.html" + type: file + description: Results in HTML format + pattern: "*.html" - log: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.log": - type: file - description: fastq log file - pattern: "*.log" + type: file + description: fastq log file + pattern: "*.log" + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" - reads_fail: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.fail.fastq.gz": - type: file - description: Reads the failed the preprocessing - pattern: "*fail.fastq.gz" + type: file + description: Reads the failed the preprocessing + pattern: "*fail.fastq.gz" - reads_merged: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.merged.fastq.gz": - type: file - description: Reads that were successfully merged - pattern: "*.{merged.fastq.gz}" - - versions: - - versions.yml: - type: file - description: File containing software versions - pattern: "versions.yml" + type: file + description: Reads that were successfully merged + pattern: "*.{merged.fastq.gz}" authors: - "@drpatelh" - "@kevinmenden" diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test index 30dbb8aa..6f1f4897 100644 --- a/modules/nf-core/fastp/tests/main.nf.test +++ b/modules/nf-core/fastp/tests/main.nf.test @@ -10,290 +10,221 @@ nextflow_process { test("test_fastp_single_end") { when { - + params { + outdir = "$outputDir" + } process { """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + input[0] = Channel.of([ [ id:'test', single_end:true ], [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)" ] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-_match") + }, + { assert snapshot(process.out.versions).match("versions_single_end") } ) } } - test("test_fastp_paired_end") { + test("test_fastp_single_end-stub") { - when { + options '-stub' + when { + params { + outdir = "$outputDir" + } process { """ adapter_fasta = [] - save_trimmed_pass = true save_trimmed_fail = false save_merged = false input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - test("fastp test_fastp_interleaved") { - - config './nextflow.interleaved.config' - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false - """ - } - } - - then { assertAll( { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, - { assert process.out.reads_fail == [] }, - { assert process.out.reads_merged == [] }, - { assert snapshot( - process.out.reads, - process.out.json, - process.out.versions).match() } + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_single_end_stub") } ) } } - test("test_fastp_single_end_trim_fail") { + test("test_fastp_paired_end") { when { - - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = true - input[4] = false - """ + params { + outdir = "$outputDir" } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("test_fastp_paired_end_trim_fail") { - - config './nextflow.save_failed.config' - when { process { """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] - ]) - input[1] = [] - input[2] = false - input[3] = true - input[4] = false - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, - { assert snapshot( - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.json, - process.out.versions).match() } - ) - } - } - - test("test_fastp_paired_end_merged") { + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false - when { - process { - """ input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = true + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end") } ) } } - test("test_fastp_paired_end_merged_adapterlist") { + test("test_fastp_paired_end-stub") { - when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) - input[2] = false - input[3] = false - input[4] = true - """ - } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("
    ") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("test_fastp_single_end_qc_only") { + options '-stub' when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = true - input[3] = false - input[4] = false - """ + params { + outdir = "$outputDir" } - } - - then { - assertAll( - { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads, - process.out.reads_fail, - process.out.reads_fail, - process.out.reads_merged, - process.out.reads_merged, - process.out.versions).match() } - ) - } - } - - test("test_fastp_paired_end_qc_only") { - - when { process { """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = true - input[3] = false - input[4] = false + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } @@ -301,99 +232,114 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, - { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, - { assert snapshot( - process.out.json, - process.out.reads, - process.out.reads, - process.out.reads_fail, - process.out.reads_fail, - process.out.reads_merged, - process.out.reads_merged, - process.out.versions).match() } + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end-stub") } ) } } - test("test_fastp_single_end - stub") { - - options "-stub" + test("fastp test_fastp_interleaved") { + config './nextflow.interleaved.config' when { - - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false - """ + params { + outdir = "$outputDir" } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_paired_end - stub") { - - options "-stub" - - when { - process { """ adapter_fasta = [] - save_trimmed_pass = true save_trimmed_fail = false save_merged = false input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "paired end (151 cycles + 151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 162"] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-_match") + }, + { assert snapshot(process.out.versions).match("versions_interleaved") } ) } } - test("fastp - stub test_fastp_interleaved") { + test("fastp test_fastp_interleaved-stub") { - options "-stub" + options '-stub' config './nextflow.interleaved.config' when { + params { + outdir = "$outputDir" + } process { """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + input[0] = Channel.of([ [ id:'test', single_end:true ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = false + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } @@ -401,112 +347,277 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out).match() } + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_interleaved-stub") } ) } } - test("test_fastp_single_end_trim_fail - stub") { - - options "-stub" + test("test_fastp_single_end_trim_fail") { when { - + params { + outdir = "$outputDir" + } process { """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + input[0] = Channel.of([ [ id:'test', single_end:true ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = false - input[3] = true - input[4] = false + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { failed_read_lines.each { failed_read_line -> + { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_single_end_trim_fail") } ) } } - test("test_fastp_paired_end_trim_fail - stub") { - - options "-stub" + test("test_fastp_paired_end_trim_fail") { config './nextflow.save_failed.config' when { + params { + outdir = "$outputDir" + } process { """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] ]) - input[1] = [] - input[2] = false - input[3] = true - input[4] = false + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 162'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { failed_read2_lines.each { failed_read2_line -> + { assert path(process.out.reads_fail.get(0).get(1).get(2)).linesGzip.contains(failed_read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_paired_end_trim_fail") } ) } } - test("test_fastp_paired_end_merged - stub") { - - options "-stub" + test("test_fastp_paired_end_merged") { when { + params { + outdir = "$outputDir" + } process { """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = false - input[3] = false - input[4] = true + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } then { + def html_text = [ "
    "] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] + def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged") } ) } } - test("test_fastp_paired_end_merged_adapterlist - stub") { + test("test_fastp_paired_end_merged-stub") { - options "-stub" + options '-stub' when { + params { + outdir = "$outputDir" + } process { """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) - input[2] = false - input[3] = false - input[4] = true + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } @@ -514,63 +625,101 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out).match() } + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged_stub") } ) } } - test("test_fastp_single_end_qc_only - stub") { - - options "-stub" + test("test_fastp_paired_end_merged_adapterlist") { when { - process { - """ - input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - input[1] = [] - input[2] = true - input[3] = false - input[4] = false - """ + params { + outdir = "$outputDir" } - } - - then { - assertAll( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("test_fastp_paired_end_qc_only - stub") { - - options "-stub" - - when { process { """ + adapter_fasta = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + save_trimmed_fail = false + save_merged = true + input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] - input[2] = true - input[3] = false - input[4] = false + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged """ } } then { + def html_text = [ "
    "] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] + def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged_adapterlist") } ) } } -} \ No newline at end of file +} diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap index 54be7e45..3e876288 100644 --- a/modules/nf-core/fastp/tests/main.nf.test.snap +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -1,178 +1,55 @@ { - "test_fastp_single_end_qc_only - stub": { + "fastp test_fastp_interleaved_json": { "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22" ] - } + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T14:31:10.841098" + "timestamp": "2024-03-18T16:19:15.063001" }, - "test_fastp_paired_end": { + "test_fastp_paired_end_merged-for_stub_match": { "content": [ [ [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", - "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" - ] - ] - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:43:28.665779" + "timestamp": "2024-01-17T18:10:13.467574" }, - "test_fastp_paired_end_merged_adapterlist": { + "versions_interleaved": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", - "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" - ] - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" - ] - ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:44:18.210375" + "timestamp": "2024-02-01T11:56:24.615634793" }, - "test_fastp_single_end_qc_only": { + "test_fastp_single_end_json": { "content": [ [ [ @@ -180,1152 +57,274 @@ "id": "test", "single_end": true }, - "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a" + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" ] - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:44:27.380974" + "timestamp": "2024-03-18T16:18:43.526412" }, - "test_fastp_paired_end_trim_fail": { + "versions_paired_end": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7", - "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a" - ] - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366", - "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6", - "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995" - ] - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519" - ] - ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:43:58.749589" + "timestamp": "2024-02-01T11:55:42.333545689" }, - "fastp - stub test_fastp_interleaved": { + "test_fastp_paired_end_match": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - } + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:50:00.270029" + "timestamp": "2024-02-01T12:03:06.431833729" }, - "test_fastp_single_end - stub": { + "test_fastp_interleaved-_match": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - } + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:49:42.502789" + "timestamp": "2024-03-18T16:19:15.111894" }, - "test_fastp_paired_end_merged_adapterlist - stub": { + "test_fastp_paired_end_merged_match": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - } + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:54:53.458252" + "timestamp": "2024-02-01T12:08:44.496251446" }, - "test_fastp_paired_end_merged - stub": { + "versions_single_end_stub": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - } + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:50:27.689379" + "timestamp": "2024-02-01T11:55:27.354051299" }, - "test_fastp_paired_end_merged": { + "versions_interleaved-stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", - "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" - ] - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" - ] - ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:44:08.68476" + "timestamp": "2024-02-01T11:56:46.535528418" }, - "test_fastp_paired_end - stub": { + "versions_single_end_trim_fail": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - } + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:49:51.679221" + "timestamp": "2024-02-01T11:59:03.724591407" }, - "test_fastp_single_end": { + "test_fastp_paired_end-for_stub_match": { "content": [ [ [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" - ] - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" - ] - ], - [ - - ], - [ - - ], + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:07:15.398827" + }, + "versions_paired_end-stub": { + "content": [ [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:43:18.834322" + "timestamp": "2024-02-01T11:56:06.50017282" }, - "test_fastp_single_end_trim_fail - stub": { + "versions_single_end": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "reads_fail": [ - [ - { - "id": "test", - "single_end": true - }, - "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - } + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T14:05:36.898142" + "timestamp": "2024-02-01T11:55:07.67921647" }, - "test_fastp_paired_end_trim_fail - stub": { + "versions_paired_end_merged_stub": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_fail": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - } + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T14:05:49.212847" + "timestamp": "2024-02-01T11:59:47.350653154" }, - "fastp test_fastp_interleaved": { + "test_fastp_interleaved-for_stub_match": { "content": [ [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,217d62dc13a23e92513a1bd8e1bcea39" - ] - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22" - ] - ], + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:06.127974" + }, + "versions_paired_end_trim_fail": { + "content": [ [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:43:38.910832" + "timestamp": "2024-02-01T11:59:18.140484878" }, - "test_fastp_single_end_trim_fail": { + "test_fastp_single_end-for_stub_match": { "content": [ [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" - ] - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" - ] - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd" - ] - ], + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:06:00.244202" + }, + "test_fastp_single_end-_match": { + "content": [ [ - - ], + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T16:18:43.580336" + }, + "versions_paired_end_merged_adapterlist": { + "content": [ [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:43:48.22378" + "timestamp": "2024-02-01T12:05:37.845370554" }, - "test_fastp_paired_end_qc_only": { + "versions_paired_end_merged": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df" - ] - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], - [ - - ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T13:44:36.334938" + "timestamp": "2024-02-01T11:59:32.860543858" }, - "test_fastp_paired_end_qc_only - stub": { + "test_fastp_single_end_trim_fail_json": { "content": [ - { - "0": [ - - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "3": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "4": [ - - ], - "5": [ - - ], - "6": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "json": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "log": [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "reads": [ - - ], - "reads_fail": [ - - ], - "reads_merged": [ - - ], - "versions": [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" ] - } + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nextflow": "23.10.1" }, - "timestamp": "2024-07-05T14:31:27.096468" + "timestamp": "2024-01-17T18:08:41.942317" } } \ No newline at end of file diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml index 691d4c76..1787b38a 100644 --- a/modules/nf-core/fastqc/environment.yml +++ b/modules/nf-core/fastqc/environment.yml @@ -1,5 +1,7 @@ +name: fastqc channels: - conda-forge - bioconda + - defaults dependencies: - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index d8989f48..9e19a74c 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -25,14 +25,6 @@ process FASTQC { def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[ reads, "${prefix}.${reads.extension}" ]] : reads.withIndex().collect { entry, index -> [ entry, "${prefix}_${index + 1}.${entry.extension}" ] } def rename_to = old_new_pairs*.join(' ').join(' ') def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') - - // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) - // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 - // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label - def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') / task.cpus - // FastQC memory value allowed range (100 - 10000) - def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) - """ printf "%s %s\\n" $rename_to | while read old_name new_name; do [ -f "\${new_name}" ] || ln -s \$old_name \$new_name @@ -41,7 +33,6 @@ process FASTQC { fastqc \\ $args \\ --threads $task.cpus \\ - --memory $fastqc_memory \\ $renamed_files cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index 4827da7a..ee5507e0 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -16,44 +16,35 @@ tools: homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/ licence: ["GPL-2.0-only"] - identifier: biotools:fastqc input: - - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - html: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.html": - type: file - description: FastQC report - pattern: "*_{fastqc.html}" + type: file + description: FastQC report + pattern: "*_{fastqc.html}" - zip: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - "*.zip": - type: file - description: FastQC report archive - pattern: "*_{fastqc.zip}" + type: file + description: FastQC report archive + pattern: "*_{fastqc.zip}" - versions: - - versions.yml: - type: file - description: File containing software versions - pattern: "versions.yml" + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index e9d79a07..70edae4d 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -23,14 +23,17 @@ nextflow_process { then { assertAll ( - { assert process.success }, - // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. - // looks like this:
    Mon 2 Oct 2023
    test.gz
    - // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } + { assert process.success }, + + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
    Mon 2 Oct 2023
    test.gz
    + // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_single") } ) } } @@ -51,14 +54,16 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } + { assert process.success }, + + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_paired") } ) } } @@ -78,11 +83,13 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } + { assert process.success }, + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } ) } } @@ -102,11 +109,13 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } + { assert process.success }, + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_bam") } ) } } @@ -129,20 +138,22 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, - { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, - { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } + { assert process.success }, + + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, + + { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } ) } } @@ -162,116 +173,27 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(process.out.versions).match() } - ) - } - } + { assert process.success }, - test("sarscov2 single-end [fastq] - stub") { + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [ id: 'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } ) } } - test("sarscov2 paired-end [fastq] - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 interleaved [fastq] - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } - - test("sarscov2 paired-end [bam] - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } + test("sarscov2 single-end [fastq] - stub") { - test("sarscov2 multiple [fastq] - stub") { + options "-stub" - options "-stub" when { process { """ input[0] = Channel.of([ - [id: 'test', single_end: false], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + [ id: 'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) """ } @@ -279,31 +201,12 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } + { assert process.success }, + { assert snapshot(process.out.html.collect { file(it[1]).getName() } + + process.out.zip.collect { file(it[1]).getName() } + + process.out.versions ).match("fastqc_stub") } ) } } - test("sarscov2 custom_prefix - stub") { - - options "-stub" - when { - process { - """ - input[0] = Channel.of([ - [ id:'mysample', single_end:true ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) - ]) - """ - } - } - - then { - assertAll ( - { assert process.success }, - { assert snapshot(process.out).match() } - ) - } - } } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index d5db3092..86f7c311 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,392 +1,88 @@ { - "sarscov2 custom_prefix": { + "fastqc_versions_interleaved": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" + "nf-test": "0.8.4", + "nextflow": "23.10.1" }, - "timestamp": "2024-07-22T11:02:16.374038" + "timestamp": "2024-01-31T17:40:07.293713" }, - "sarscov2 single-end [fastq] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": true - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": true - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": true - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:02:24.993809" - }, - "sarscov2 custom_prefix - stub": { - "content": [ - { - "0": [ - [ - { - "id": "mysample", - "single_end": true - }, - "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "mysample", - "single_end": true - }, - "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "mysample", - "single_end": true - }, - "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "mysample", - "single_end": true - }, - "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:03:10.93942" - }, - "sarscov2 interleaved [fastq]": { + "fastqc_stub": { "content": [ [ + "test.html", + "test.zip", "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" + "nf-test": "0.8.4", + "nextflow": "23.10.1" }, - "timestamp": "2024-07-22T11:01:42.355718" + "timestamp": "2024-01-31T17:31:01.425198" }, - "sarscov2 paired-end [bam]": { + "fastqc_versions_multiple": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" + "nf-test": "0.8.4", + "nextflow": "23.10.1" }, - "timestamp": "2024-07-22T11:01:53.276274" + "timestamp": "2024-01-31T17:40:55.797907" }, - "sarscov2 multiple [fastq]": { + "fastqc_versions_bam": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" + "nf-test": "0.8.4", + "nextflow": "23.10.1" }, - "timestamp": "2024-07-22T11:02:05.527626" + "timestamp": "2024-01-31T17:40:26.795862" }, - "sarscov2 paired-end [fastq]": { + "fastqc_versions_single": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:01:31.188871" - }, - "sarscov2 paired-end [fastq] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" + "nf-test": "0.8.4", + "nextflow": "23.10.1" }, - "timestamp": "2024-07-22T11:02:34.273566" + "timestamp": "2024-01-31T17:39:27.043675" }, - "sarscov2 multiple [fastq] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:03:02.304411" - }, - "sarscov2 single-end [fastq]": { + "fastqc_versions_paired": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" - }, - "timestamp": "2024-07-22T11:01:19.095607" - }, - "sarscov2 interleaved [fastq] - stub": { - "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } - ], - "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" + "nf-test": "0.8.4", + "nextflow": "23.10.1" }, - "timestamp": "2024-07-22T11:02:44.640184" + "timestamp": "2024-01-31T17:39:47.584191" }, - "sarscov2 paired-end [bam] - stub": { + "fastqc_versions_custom_prefix": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "1": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "2": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "html": [ - [ - { - "id": "test", - "single_end": false - }, - "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ], - "versions": [ - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ], - "zip": [ - [ - { - "id": "test", - "single_end": false - }, - "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" - ] - ] - } + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] ], "meta": { - "nf-test": "0.9.0", - "nextflow": "24.04.3" + "nf-test": "0.8.4", + "nextflow": "23.10.1" }, - "timestamp": "2024-07-22T11:02:53.550742" + "timestamp": "2024-01-31T17:41:14.576531" } } \ No newline at end of file diff --git a/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf b/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf index a7b856ba..4f1c84fc 100644 --- a/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf +++ b/subworkflows/nf-core/fastq_trim_fastp_fastqc/main.nf @@ -52,7 +52,6 @@ workflow FASTQ_TRIM_FASTP_FASTQC { FASTP ( ch_reads, ch_adapter_fasta, - false, val_save_trimmed_fail, val_save_merged ) diff --git a/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml b/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml index fb2d12fd..9f4e12e0 100644 --- a/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml +++ b/subworkflows/nf-core/fastq_trim_fastp_fastqc/meta.yml @@ -46,7 +46,7 @@ input: skip the fastp process if true output: - meta: - type: string + type: value description: Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - reads: type: file From b86a1a8493568d3fab073ebd6886318294ddc6cc Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 11 Oct 2024 16:41:10 +0200 Subject: [PATCH 45/70] update CHANGELOG in #176 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 923df4d6..e314323f 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -14,6 +14,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Added` +- [#176](https://github.com/nf-core/bacass/pull/176) Update nf-core/bacass to nf-core-tools v3.0.2 `TEMPLATE`. - [#166](https://github.com/nf-core/bacass/pull/166) Added FastQC after-trimming section to MultiQC report. ### `Fixed` From 2083999ef317d9a52ef578072505726e82644035 Mon Sep 17 00:00:00 2001 From: Daniel VM <69470278+Daniel-VM@users.noreply.github.com> Date: Tue, 15 Oct 2024 15:28:09 +0200 Subject: [PATCH 46/70] Apply suggestions from code review MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit Co-authored-by: Matthias Hörtenhuber --- .nf-core.yml | 3 ++- CITATIONS.md | 2 +- 2 files changed, 3 insertions(+), 2 deletions(-) diff --git a/.nf-core.yml b/.nf-core.yml index b089730b..38f44e0d 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -16,6 +16,7 @@ template: name: bacass org: nf-core outdir: . - skip_features: null + skip_features: + - igenomes version: 2.4.0dev update: null diff --git a/CITATIONS.md b/CITATIONS.md index aa5481fa..9d2ab889 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -12,7 +12,7 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) -> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. + > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - [FastP](https://github.com/OpenGene/fastp) From 8a8182a4917f9513370b3c07525e7048e11060c1 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Tue, 15 Oct 2024 13:31:59 +0000 Subject: [PATCH 47/70] [automated] Fix code linting --- .nf-core.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.nf-core.yml b/.nf-core.yml index 38f44e0d..84c59bef 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -16,7 +16,7 @@ template: name: bacass org: nf-core outdir: . - skip_features: + skip_features: - igenomes version: 2.4.0dev update: null From cc0ae3a303465788305c771796a1a6e6732aaf9f Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 29 Aug 2024 14:12:20 +0200 Subject: [PATCH 48/70] added module cat_fastq --- assets/schema_input.json | 2 +- modules.json | 5 + modules/nf-core/cat/fastq/environment.yml | 7 + modules/nf-core/cat/fastq/main.nf | 79 ++++ modules/nf-core/cat/fastq/meta.yml | 42 ++ modules/nf-core/cat/fastq/tests/main.nf.test | 248 ++++++++++++ .../nf-core/cat/fastq/tests/main.nf.test.snap | 376 ++++++++++++++++++ modules/nf-core/cat/fastq/tests/tags.yml | 2 + .../utils_nfcore_bacass_pipeline/main.nf | 2 +- workflows/bacass.nf | 38 +- 10 files changed, 789 insertions(+), 12 deletions(-) create mode 100644 modules/nf-core/cat/fastq/environment.yml create mode 100644 modules/nf-core/cat/fastq/main.nf create mode 100644 modules/nf-core/cat/fastq/meta.yml create mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test create mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test.snap create mode 100644 modules/nf-core/cat/fastq/tests/tags.yml diff --git a/assets/schema_input.json b/assets/schema_input.json index 3cf372d0..a2681a45 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -10,7 +10,7 @@ "ID": { "type": "string", "pattern": "^\\S+$", - "unique": true, + "unique": false, "errorMessage": "Sample name must be provided and cannot contain spaces", "meta": ["id"] }, diff --git a/modules.json b/modules.json index ba06f0ab..065534eb 100644 --- a/modules.json +++ b/modules.json @@ -20,6 +20,11 @@ "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, + "cat/fastq": { + "branch": "master", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", + "installed_by": ["modules"] + }, "dragonflye": { "branch": "master", "git_sha": "a3ae45e99f68e513b0feb8d5f27e2fdd0d0f083d", diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml new file mode 100644 index 00000000..8c69b121 --- /dev/null +++ b/modules/nf-core/cat/fastq/environment.yml @@ -0,0 +1,7 @@ +name: cat_fastq +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - conda-forge::coreutils=8.30 diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf new file mode 100644 index 00000000..b68e5f91 --- /dev/null +++ b/modules/nf-core/cat/fastq/main.nf @@ -0,0 +1,79 @@ +process CAT_FASTQ { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : + 'nf-core/ubuntu:20.04' }" + + input: + tuple val(meta), path(reads, stageAs: "input*/*") + + output: + tuple val(meta), path("*.merged.fastq.gz"), emit: reads + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()] + if (meta.single_end) { + if (readList.size >= 1) { + """ + cat ${readList.join(' ')} > ${prefix}.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } + } else { + if (readList.size >= 2) { + def read1 = [] + def read2 = [] + readList.eachWithIndex{ v, ix -> ( ix & 1 ? read2 : read1 ) << v } + """ + cat ${read1.join(' ')} > ${prefix}_1.merged.fastq.gz + cat ${read2.join(' ')} > ${prefix}_2.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } + } + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()] + if (meta.single_end) { + if (readList.size >= 1) { + """ + echo '' | gzip > ${prefix}.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } + } else { + if (readList.size >= 2) { + """ + echo '' | gzip > ${prefix}_1.merged.fastq.gz + echo '' | gzip > ${prefix}_2.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } + } +} diff --git a/modules/nf-core/cat/fastq/meta.yml b/modules/nf-core/cat/fastq/meta.yml new file mode 100644 index 00000000..db4ac3c7 --- /dev/null +++ b/modules/nf-core/cat/fastq/meta.yml @@ -0,0 +1,42 @@ +name: cat_fastq +description: Concatenates fastq files +keywords: + - cat + - fastq + - concatenate +tools: + - cat: + description: | + The cat utility reads files sequentially, writing them to the standard output. + documentation: https://www.gnu.org/software/coreutils/manual/html_node/cat-invocation.html + licence: ["GPL-3.0-or-later"] +input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files to be concatenated. +output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: Merged fastq file + pattern: "*.{merged.fastq.gz}" + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@joseespinosa" + - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test new file mode 100644 index 00000000..f88a78b6 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -0,0 +1,248 @@ +// NOTE The version snaps may not be consistant +// https://github.com/nf-core/modules/pull/4087#issuecomment-1767948035 +nextflow_process { + + name "Test Process CAT_FASTQ" + script "../main.nf" + process "CAT_FASTQ" + tag "modules" + tag "modules_nfcore" + tag "cat" + tag "cat/fastq" + + test("test_cat_fastq_single_end") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_same_name") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end_same_name") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_single_file") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_single_file - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap new file mode 100644 index 00000000..aec119a9 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -0,0 +1,376 @@ +{ + "test_cat_fastq_single_end": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-01-17T17:30:39.816981" + }, + "test_cat_fastq_single_end_same_name": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-01-17T17:32:35.229332" + }, + "test_cat_fastq_single_end_single_file": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-01-17T17:34:00.058829" + }, + "test_cat_fastq_paired_end_same_name": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-01-17T17:33:33.031555" + }, + "test_cat_fastq_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:28.244999" + }, + "test_cat_fastq_paired_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:57.070911" + }, + "test_cat_fastq_single_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:46.796254" + }, + "test_cat_fastq_paired_end": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-01-17T17:32:02.270935" + }, + "test_cat_fastq_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:37.807553" + }, + "test_cat_fastq_single_end_single_file - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:14:51.861264" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml new file mode 100644 index 00000000..6ac43614 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/tags.yml @@ -0,0 +1,2 @@ +cat/fastq: + - modules/nf-core/cat/fastq/** diff --git a/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf b/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf index 3cdbca34..c1febf37 100644 --- a/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_bacass_pipeline/main.nf @@ -88,7 +88,7 @@ workflow PIPELINE_INITIALISATION { } .map { meta, fastqs, longread, fast5 -> - return [ meta, fastqs.flatten(), longread, fast5 ] + return [ meta, fastqs, longread[0], fast5[0] ] } .set { ch_samplesheet } diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 01d17f9e..c6d07aae 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -20,7 +20,7 @@ include { MULTIQC_CUSTOM } from '../modules/local/multiqc_custom' // MODULE: Installed directly from nf-core/modules // include { FASTQC } from '../modules/nf-core/fastqc/main' -include { MULTIQC } from '../modules/nf-core/multiqc/main' +include { CAT_FASTQ } from '../modules/nf-core/cat/fastq' include { NANOPLOT } from '../modules/nf-core/nanoplot/main' include { PORECHOP_PORECHOP } from '../modules/nf-core/porechop/porechop/main' include { CANU } from '../modules/nf-core/canu/main' @@ -77,21 +77,18 @@ workflow BACASS { main: ch_versions = Channel.empty() ch_multiqc_files = Channel.empty() + // // SUBWORKFLOW: Read in samplesheet, validate and stage input files // def criteria = multiMapCriteria { - meta, fastq_1, fastq_2, long_fastq, fast5 -> - shortreads: fastq_1 != 'NA' ? tuple(meta, [file(fastq_1, checkIfExists: true), file(fastq_2, checkIfExists: true)]) : null - longreads: long_fastq != 'NA' ? tuple(meta, file(long_fastq, checkIfExists: true)) : null - fast5: fast5 != 'NA' ? tuple(meta, file(fast5, checkIfExists: true)) : null + meta, fastqs, long_fastq, fast5 -> + shortreads: meta.single_end != 'NA' ? tuple(meta, fastqs) : null + longreads: long_fastq != 'NA' ? tuple(meta,long_fastq) : null + fast5: fast5 != 'NA' ? tuple(meta, fast5) : null } // See the documentation https://nextflow-io.github.io/nf-validation/samplesheets/fromSamplesheet/ ch_samplesheet - .map { - meta, fastqs, long_fastq, fast5 -> - return [meta, fastqs[0], fastqs[1], long_fastq[0], fast5[0]] - } .multiMap (criteria) .set { ch_input } @@ -99,7 +96,7 @@ workflow BACASS { ch_input .shortreads .filter{ it != null } - .set { ch_shortreads } + .set { ch_shortreads_cat } ch_input .longreads .filter{ it != null } @@ -109,6 +106,27 @@ workflow BACASS { .filter{ it != null } .set { ch_fast5 } + // + // MODULE: Concatenate FastQ files from same sample if required (shortreads) + // + ch_shortreads + .branch{ + meta, fastqs -> + single: fastqs.size() == 1 + return [meta, fastqs.flatten() ] + multiple: fastqs.size() > 1 + return [meta, fastqs.flatten() ] + } + .set { ch_shortreads_cat } + + CAT_FASTQ ( + ch_shortreads_cat.multiple + ) + .reads + .mix( ch_shortreads_cat.single ) + .set { ch_shortreads } + ch_versions = ch_versions.mix(CAT_FASTQ.out.versions.first().ifEmpty(null)) + // // SUBWORKFLOW: Short reads QC and trim adapters // From b2ab59ce83378cd03b19fb1e7e49af54bb6ae0ea Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 29 Aug 2024 15:56:02 +0200 Subject: [PATCH 49/70] fix wrong variable naming --- workflows/bacass.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index c6d07aae..8b23ab9d 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -96,7 +96,7 @@ workflow BACASS { ch_input .shortreads .filter{ it != null } - .set { ch_shortreads_cat } + .set { ch_shortreads } ch_input .longreads .filter{ it != null } From 1f2b944a73e41eeb3de6c088a45e2c9a84e5a0af Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 29 Aug 2024 16:06:30 +0200 Subject: [PATCH 50/70] update changelog #158 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index e314323f..f4ceb201 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -16,6 +16,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 - [#176](https://github.com/nf-core/bacass/pull/176) Update nf-core/bacass to nf-core-tools v3.0.2 `TEMPLATE`. - [#166](https://github.com/nf-core/bacass/pull/166) Added FastQC after-trimming section to MultiQC report. +- [#158](https://github.com/nf-core/bacass/pull/158) Support automatic concatenation of FastQ files for the same sample. ### `Fixed` From 2df4fca9a6da4f8e408789163af1eca2bafddb02 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 29 Aug 2024 16:38:31 +0200 Subject: [PATCH 51/70] fixed channel versions and rename variables --- workflows/bacass.nf | 22 +++++++++++----------- 1 file changed, 11 insertions(+), 11 deletions(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 8b23ab9d..85f400ab 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -113,19 +113,19 @@ workflow BACASS { .branch{ meta, fastqs -> single: fastqs.size() == 1 - return [meta, fastqs.flatten() ] + return [ meta, fastqs.flatten() ] multiple: fastqs.size() > 1 - return [meta, fastqs.flatten() ] + return [ meta, fastqs.flatten() ] } - .set { ch_shortreads_cat } + .set { ch_shortreads_fastqs } - CAT_FASTQ ( - ch_shortreads_cat.multiple - ) - .reads - .mix( ch_shortreads_cat.single ) - .set { ch_shortreads } - ch_versions = ch_versions.mix(CAT_FASTQ.out.versions.first().ifEmpty(null)) + CAT_FASTQ ( + ch_shortreads_fastqs.multiple + ) + .reads + .mix( ch_shortreads_fastqs.single ) + .set { ch_shortreads_concat } + ch_versions = ch_versions.mix(CAT_FASTQ.out.versions) // // SUBWORKFLOW: Short reads QC and trim adapters @@ -135,7 +135,7 @@ workflow BACASS { ch_fastp_json_multiqc = Channel.empty() if (params.assembly_type != 'long'){ FASTQ_TRIM_FASTP_FASTQC ( - ch_shortreads, + ch_shortreads_concat, [], params.save_trimmed_fail, [], From cb0c18d6707c9ff57309ddbe287930ba831fd41b Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 15 Oct 2024 17:11:34 +0200 Subject: [PATCH 52/70] align spaces --- workflows/bacass.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 85f400ab..293056cd 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -19,7 +19,7 @@ include { MULTIQC_CUSTOM } from '../modules/local/multiqc_custom' // // MODULE: Installed directly from nf-core/modules // -include { FASTQC } from '../modules/nf-core/fastqc/main' +include { FASTQC } from '../modules/nf-core/fastqc/main' include { CAT_FASTQ } from '../modules/nf-core/cat/fastq' include { NANOPLOT } from '../modules/nf-core/nanoplot/main' include { PORECHOP_PORECHOP } from '../modules/nf-core/porechop/porechop/main' From 890f44cca27169b91db63844501cae4acb133f86 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 24 Oct 2024 13:59:20 +0200 Subject: [PATCH 53/70] fix bakta running only for one sample --- subworkflows/local/bakta_dbdownload_run.nf | 9 +++++++-- 1 file changed, 7 insertions(+), 2 deletions(-) diff --git a/subworkflows/local/bakta_dbdownload_run.nf b/subworkflows/local/bakta_dbdownload_run.nf index 675adcbe..6822ba67 100644 --- a/subworkflows/local/bakta_dbdownload_run.nf +++ b/subworkflows/local/bakta_dbdownload_run.nf @@ -43,9 +43,14 @@ workflow BAKTA_DBDOWNLOAD_RUN { // // MODULE: BAKTA, gene annotation // + // Setup input channel for Bakta process + ch_fasta + .combine(ch_baktadb) + .set{ ch_to_bakta } + ch_to_bakta.view() BAKTA_BAKTA ( - ch_fasta, - ch_baktadb, + ch_to_bakta.map{ meta, fasta, bakta_db -> [meta, fasta] }, + ch_to_bakta.map{ meta, fasta, bakta_db -> bakta_db }, [], [] ) From 9e622f147d3f2515741c8e219954e5e7704db653 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 24 Oct 2024 14:04:21 +0200 Subject: [PATCH 54/70] add changelog in #178 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index e314323f..33ee3cd7 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -19,6 +19,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#178](https://github.com/nf-core/bacass/pull/178) Fixed bakta running only for one sample. - [#169](https://github.com/nf-core/bacass/pull/169) Fixed long reads polishing input channel. - [#168](https://github.com/nf-core/bacass/pull/168) Fix wrong metadata in canu input channel. - [#163](https://github.com/nf-core/bacass/pull/163) Fixed `params.save_merged` to properly save merged files. From 10a7df89e922cee689feaf04c57d075b34352f27 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 24 Oct 2024 15:42:19 +0200 Subject: [PATCH 55/70] include resequenced samples in test profile --- conf/test.config | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/conf/test.config b/conf/test.config index 166c9b0c..ea960ea1 100644 --- a/conf/test.config +++ b/conf/test.config @@ -23,7 +23,7 @@ params { config_profile_description = 'Minimal test dataset to check pipeline function' // Input data - input = params.pipelines_testdata_base_path + 'bacass/bacass_short.tsv' + input = params.pipelines_testdata_base_path + 'bacass/bacass_short_reseq.tsv' // some extra args to speed tests up prokka_args = " --fast" From 4ed19cbd9d17746a864d335c9148db11061d4e99 Mon Sep 17 00:00:00 2001 From: Daniel VM <69470278+Daniel-VM@users.noreply.github.com> Date: Thu, 24 Oct 2024 17:24:14 +0200 Subject: [PATCH 56/70] remove view operator Co-authored-by: Jasmin Frangenberg <73216762+jasmezz@users.noreply.github.com> --- subworkflows/local/bakta_dbdownload_run.nf | 1 - 1 file changed, 1 deletion(-) diff --git a/subworkflows/local/bakta_dbdownload_run.nf b/subworkflows/local/bakta_dbdownload_run.nf index 6822ba67..d5fc41be 100644 --- a/subworkflows/local/bakta_dbdownload_run.nf +++ b/subworkflows/local/bakta_dbdownload_run.nf @@ -47,7 +47,6 @@ workflow BAKTA_DBDOWNLOAD_RUN { ch_fasta .combine(ch_baktadb) .set{ ch_to_bakta } - ch_to_bakta.view() BAKTA_BAKTA ( ch_to_bakta.map{ meta, fasta, bakta_db -> [meta, fasta] }, ch_to_bakta.map{ meta, fasta, bakta_db -> bakta_db }, From 5a9559c3c27123082048bc9f6953d12f763c247a Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 25 Oct 2024 10:08:04 +0200 Subject: [PATCH 57/70] fix ambigous channel creation --- subworkflows/local/bakta_dbdownload_run.nf | 15 +++++---------- 1 file changed, 5 insertions(+), 10 deletions(-) diff --git a/subworkflows/local/bakta_dbdownload_run.nf b/subworkflows/local/bakta_dbdownload_run.nf index d5fc41be..8b3c1fdb 100644 --- a/subworkflows/local/bakta_dbdownload_run.nf +++ b/subworkflows/local/bakta_dbdownload_run.nf @@ -25,16 +25,14 @@ workflow BAKTA_DBDOWNLOAD_RUN { // MODULE: untar database UNTAR( ch_baktadb_tar ) - ch_baktadb = UNTAR.out.untar.map{ meta, db -> db } + ch_path_baktadb = UNTAR.out.untar.map{ meta, db -> db } ch_versions = ch_versions.mix(UNTAR.out.versions) - } else { - ch_baktadb = Channel.from(ch_path_baktadb).map{ db -> db } } } else if (!ch_path_baktadb && val_baktadb_download){ // MODULE: Downlado Bakta database from zenodo BAKTA_BAKTADBDOWNLOAD() - ch_baktadb = BAKTA_BAKTADBDOWNLOAD.out.db - ch_versions = ch_versions.mix(BAKTA_BAKTADBDOWNLOAD.out.versions) + ch_path_baktadb = BAKTA_BAKTADBDOWNLOAD.out.db + ch_versions = ch_versions.mix(BAKTA_BAKTADBDOWNLOAD.out.versions) } else if (!ch_path_baktadb && !val_baktadb_download ){ exit 1, "The Bakta database argument is missing. To enable the workflow to access the Bakta database, please include the path using '--baktadb' or use '--bakdtadb_download true' to download the Bakta database." @@ -44,12 +42,9 @@ workflow BAKTA_DBDOWNLOAD_RUN { // MODULE: BAKTA, gene annotation // // Setup input channel for Bakta process - ch_fasta - .combine(ch_baktadb) - .set{ ch_to_bakta } BAKTA_BAKTA ( - ch_to_bakta.map{ meta, fasta, bakta_db -> [meta, fasta] }, - ch_to_bakta.map{ meta, fasta, bakta_db -> bakta_db }, + ch_fasta, + ch_path_baktadb, [], [] ) From 2bccce19bfc5880dd96cce5cc53cdb3fb8eb8070 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 25 Oct 2024 10:24:55 +0200 Subject: [PATCH 58/70] fixed matrix.test_name in linting --- .github/workflows/ci.yml | 4 ++++ 1 file changed, 4 insertions(+) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index b49a5fcb..407121b7 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -35,6 +35,10 @@ jobs: - "singularity" test_name: - "test" + - "test_long" + - "test_long_miniasm" + - "test_hybrid" + - "test_dfast" isMaster: - ${{ github.base_ref == 'master' }} # Exclude conda and singularity on dev From fd2b54e814f2d73961f8f288ae7c73159450a645 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 25 Oct 2024 11:34:00 +0200 Subject: [PATCH 59/70] remove parameter section in git ci --- .github/workflows/ci.yml | 6 ------ 1 file changed, 6 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 407121b7..e234aaa3 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -47,12 +47,6 @@ jobs: profile: "conda" - isMaster: false profile: "singularity" - parameters: - - "test" - - "test_long" - - "test_long_miniasm" - - "test_hybrid" - - "test_dfast" steps: - name: Check out pipeline code From 85bdf8540dc7fb2b1ae37cc353eaa5f3c500e068 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 25 Oct 2024 11:57:56 +0200 Subject: [PATCH 60/70] implement missing features in memory set up from nf-core tools 3.0.2 --- assets/schema_input.json | 4 ---- conf/test_dfast.config | 14 +++++++++----- conf/test_full.config | 9 +++++++++ conf/test_hybrid.config | 14 +++++++++----- conf/test_hybrid_dragonflye.config | 14 +++++++++----- conf/test_long.config | 14 +++++++++----- conf/test_long_dragonflye.config | 8 ++++++++ conf/test_long_miniasm.config | 14 +++++++++----- 8 files changed, 62 insertions(+), 29 deletions(-) diff --git a/assets/schema_input.json b/assets/schema_input.json index 3cf372d0..87587266 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -19,7 +19,6 @@ "anyOf": [ { "type": ["string", "null"], - "exists": true, "pattern": "^(\\S+\\.f(ast)?q\\.gz|NA)$" }, { @@ -33,7 +32,6 @@ "anyOf": [ { "type": ["string", "null"], - "exists": true, "pattern": "^(\\S+\\.f(ast)?q\\.gz|NA)$" }, { @@ -47,7 +45,6 @@ "anyOf": [ { "type": ["string", "null"], - "exists": true, "pattern": "^(\\S+\\.f(ast)?q\\.gz|NA)$" }, { @@ -61,7 +58,6 @@ "anyOf": [ { "type": ["string", "null"], - "exists": true, "pattern": "^(\\/[\\S\\s]*|NA)$" }, { diff --git a/conf/test_dfast.config b/conf/test_dfast.config index e2d0afe2..ada68c6c 100644 --- a/conf/test_dfast.config +++ b/conf/test_dfast.config @@ -10,15 +10,19 @@ ---------------------------------------------------------------------------------------- */ +// Limit resources so that this can run on GitHub Actions +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test_dfast profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = 6.GB - max_time = 6.h - // Input data input = params.pipelines_testdata_base_path + 'bacass/bacass_short.tsv' diff --git a/conf/test_full.config b/conf/test_full.config index f3dc621c..6535fd4e 100644 --- a/conf/test_full.config +++ b/conf/test_full.config @@ -10,6 +10,15 @@ ---------------------------------------------------------------------------------------- */ +// Limit resources so that this can run on GitHub Actions +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Full test profile' config_profile_description = 'Full test dataset to check pipeline function' diff --git a/conf/test_hybrid.config b/conf/test_hybrid.config index a524de07..3ddad519 100644 --- a/conf/test_hybrid.config +++ b/conf/test_hybrid.config @@ -10,15 +10,19 @@ ---------------------------------------------------------------------------------------- */ +// Limit resources so that this can run on GitHub Actions +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = 6.GB - max_time = 6.h - // Input data input = params.pipelines_testdata_base_path + 'bacass/bacass_hybrid.tsv' diff --git a/conf/test_hybrid_dragonflye.config b/conf/test_hybrid_dragonflye.config index 9cf34364..349c540e 100644 --- a/conf/test_hybrid_dragonflye.config +++ b/conf/test_hybrid_dragonflye.config @@ -10,15 +10,19 @@ ---------------------------------------------------------------------------------------- */ +// Limit resources so that this can run on GitHub Actions +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test hybrid-dragonflye profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = 6.GB - max_time = 6.h - // Input data input = params.pipelines_testdata_base_path + 'bacass/bacass_hybrid_dragonflye.tsv' diff --git a/conf/test_long.config b/conf/test_long.config index 3cc3a8b6..3ebc421b 100644 --- a/conf/test_long.config +++ b/conf/test_long.config @@ -10,15 +10,19 @@ ---------------------------------------------------------------------------------------- */ +// Limit resources so that this can run on GitHub Actions +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test_long profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = 6.GB - max_time = 6.h - // Input data input = params.pipelines_testdata_base_path + 'bacass/bacass_long_miniasm.tsv' diff --git a/conf/test_long_dragonflye.config b/conf/test_long_dragonflye.config index 38301d47..07f1bf57 100644 --- a/conf/test_long_dragonflye.config +++ b/conf/test_long_dragonflye.config @@ -9,6 +9,14 @@ ---------------------------------------------------------------------------------------- */ +// Limit resources so that this can run on GitHub Actions +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} params { config_profile_name = 'Test_long_dragonfyle profile' diff --git a/conf/test_long_miniasm.config b/conf/test_long_miniasm.config index d6b5874e..ab2dd10e 100644 --- a/conf/test_long_miniasm.config +++ b/conf/test_long_miniasm.config @@ -10,15 +10,19 @@ ---------------------------------------------------------------------------------------- */ +// Limit resources so that this can run on GitHub Actions +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test_long_miniasm profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = 6.GB - max_time = 6.h - // Input data input = params.pipelines_testdata_base_path + 'bacass/bacass_long_miniasm.tsv' From aa42f9517977013b6340a34a44ecdd42b61a3580 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 25 Oct 2024 11:59:43 +0200 Subject: [PATCH 61/70] update changelog #179 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 33ee3cd7..8ea7ef29 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -19,6 +19,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#179](https://github.com/nf-core/bacass/pull/179) Fixed matrix.test_name in linting and missing features from template 3.0.2. - [#178](https://github.com/nf-core/bacass/pull/178) Fixed bakta running only for one sample. - [#169](https://github.com/nf-core/bacass/pull/169) Fixed long reads polishing input channel. - [#168](https://github.com/nf-core/bacass/pull/168) Fix wrong metadata in canu input channel. From 8434c60edd9794c4bf8da1c8eabf3aeaab2cf886 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Thu, 24 Oct 2024 16:22:42 +0200 Subject: [PATCH 62/70] bump version 2.4.0 --- CHANGELOG.md | 2 +- assets/multiqc_config.yml | 4 ++-- nextflow.config | 2 +- 3 files changed, 4 insertions(+), 4 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index de65fe69..045d36f2 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v2.4.0dev nf-core/bacass +## v2.4.0 nf-core/bacass: "Yellow Copper Crayfish" 2024/10/24 ### `Changed` diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index 6f6ef075..a247bc78 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,7 +1,7 @@ report_comment: > - This report has been generated by the nf-core/bacass + This report has been generated by the nf-core/bacass analysis pipeline. For information about how to interpret these results, please see the - documentation. + documentation. max_table_rows: 10000 diff --git a/nextflow.config b/nextflow.config index 9131be65..e56b957f 100644 --- a/nextflow.config +++ b/nextflow.config @@ -264,7 +264,7 @@ manifest { description = """Simple bacterial assembly and annotation""" mainScript = 'main.nf' nextflowVersion = '!>=24.04.2' - version = '2.4.0dev' + version = '2.4.0' doi = '10.5281/zenodo.2669428' } From f1809cec9f740f586da0736366273ff0b3c9e55e Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Fri, 25 Oct 2024 12:11:26 +0200 Subject: [PATCH 63/70] update changelog #180 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 045d36f2..fd8dc211 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -7,6 +7,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Changed` +- [#180](https://github.com/nf-core/bacass/pull/180) Bump version 2.4.0. - [#169](https://github.com/nf-core/bacass/pull/169) Refactored long-reads polishing step. - [#167](https://github.com/nf-core/bacass/pull/167) Remove params.save_merged as merged reads are not used in downstream analysis. - [#159](https://github.com/nf-core/bacass/pull/159) Updated Kmerfinder module and increased memory. From 9c95fb780bb92728a47ffe1de662152e36122bdc Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 5 Nov 2024 12:04:47 +0100 Subject: [PATCH 64/70] fix release date in #180 --- CHANGELOG.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index fd8dc211..e0bb1181 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v2.4.0 nf-core/bacass: "Yellow Copper Crayfish" 2024/10/24 +## v2.4.0 nf-core/bacass: "Yellow Copper Crayfish" 2024/11/05 ### `Changed` From 262f74105d2ba63dd93b5db9464d9f7aea4a4887 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 5 Nov 2024 15:21:44 +0100 Subject: [PATCH 65/70] uncomment required line for linting in --release mode --- nextflow.config | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/nextflow.config b/nextflow.config index e56b957f..ff9faeda 100644 --- a/nextflow.config +++ b/nextflow.config @@ -204,7 +204,7 @@ includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${pa // Load nf-core/bacass custom profiles from different institutions. // TODO nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs -// includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/bacass.config" : "/dev/null" +includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/bacass.config" : "/dev/null" // Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile // Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled From e241ff879de1d36644c8e3d90e78a828003f0816 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Tue, 5 Nov 2024 15:29:37 +0100 Subject: [PATCH 66/70] update changelog in #182 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index e0bb1181..f160d6a0 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -21,6 +21,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#182](https://github.com/nf-core/bacass/pull/182) Uncommented required line to pass linting test in `--release` mode. - [#179](https://github.com/nf-core/bacass/pull/179) Fixed matrix.test_name in linting and missing features from template 3.0.2. - [#178](https://github.com/nf-core/bacass/pull/178) Fixed bakta running only for one sample. - [#169](https://github.com/nf-core/bacass/pull/169) Fixed long reads polishing input channel. From ad68b1f1cd0cdc067f159cd2fc8f302ec6044735 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 6 Nov 2024 13:07:42 +0100 Subject: [PATCH 67/70] fix dfast conda issue by updating version --- modules/local/dfast/environment.yml | 2 +- modules/local/dfast/main.nf | 4 ++-- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/modules/local/dfast/environment.yml b/modules/local/dfast/environment.yml index f5542598..f532ca2c 100644 --- a/modules/local/dfast/environment.yml +++ b/modules/local/dfast/environment.yml @@ -4,4 +4,4 @@ channels: - bioconda - defaults dependencies: - - bioconda::dfast=1.2.20 + - bioconda::dfast=1.3.2 diff --git a/modules/local/dfast/main.nf b/modules/local/dfast/main.nf index 3d82b660..1dacc331 100644 --- a/modules/local/dfast/main.nf +++ b/modules/local/dfast/main.nf @@ -4,8 +4,8 @@ process DFAST { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/dfast:1.2.20--h43eeafb_0' : - 'biocontainers/dfast:1.2.20--h43eeafb_0' }" + 'https://depot.galaxyproject.org/singularity/dfast:1.3.2--h43eeafb_0' : + 'biocontainers/dfast:1.3.2--h43eeafb_0' }" input: tuple val(meta), path(fasta) From 0f7646a742a7fe470edd9a5b2cfd85943e5f8a7c Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Wed, 6 Nov 2024 13:50:50 +0100 Subject: [PATCH 68/70] update changelog in #183 --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index f160d6a0..950287d1 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -21,6 +21,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#183](https://github.com/nf-core/bacass/pull/183) Fix DFAST issue in conda environment by updating its version. - [#182](https://github.com/nf-core/bacass/pull/182) Uncommented required line to pass linting test in `--release` mode. - [#179](https://github.com/nf-core/bacass/pull/179) Fixed matrix.test_name in linting and missing features from template 3.0.2. - [#178](https://github.com/nf-core/bacass/pull/178) Fixed bakta running only for one sample. From bf367e40c29be8ae608c32eb1db1d2134e9b133d Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Mon, 18 Nov 2024 12:39:07 +0100 Subject: [PATCH 69/70] added code review from #181 --- .github/workflows/awsfulltest.yml | 1 + .nf-core.yml | 2 +- CHANGELOG.md | 5 +++++ conf/base.config | 2 +- conf/modules.config | 3 --- workflows/bacass.nf | 3 --- 6 files changed, 8 insertions(+), 8 deletions(-) diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index dd5acbfb..3d60a624 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -20,6 +20,7 @@ jobs: steps: - uses: octokit/request-action@v2.x id: check_approvals + if: github.event_name != 'workflow_dispatch' with: route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews env: diff --git a/.nf-core.yml b/.nf-core.yml index 84c59bef..875c078e 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -18,5 +18,5 @@ template: outdir: . skip_features: - igenomes - version: 2.4.0dev + version: 2.4.0 update: null diff --git a/CHANGELOG.md b/CHANGELOG.md index 950287d1..df87f3cb 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -35,6 +35,11 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Dependencies` +| Tool | Previous version | New version | +| ---------- | ---------------- | ----------- | +| Dfast | 1.2.20 | 1.3.2 | +| Unicycler | 0.4.8 | 0.5.0 | + ### `Deprecated` ## v2.3.1 nf-core/bacass: "Navy Iron Oyster" 2024/06/24 diff --git a/conf/base.config b/conf/base.config index 5dc3f9ea..bad115d6 100644 --- a/conf/base.config +++ b/conf/base.config @@ -15,7 +15,7 @@ process { time = { 4.h * task.attempt } errorStrategy = { task.exitStatus in ((130..145) + 104) ? 'retry' : 'finish' } - maxRetries = 1 + maxRetries = 3 maxErrors = '-1' // Process-specific resource requirements diff --git a/conf/modules.config b/conf/modules.config index 03241683..7b0bc4a1 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -299,9 +299,6 @@ if (!params.skip_fastp) { if (!params.skip_kmerfinder) { process { withName: '.*:.*:KMERFINDER_SUBWORKFLOW:KMERFINDER' { - errorStrategy = { task.exitStatus in [1, 137, 139] ? 'retry' : 'finish'} - maxRetries = 3 - ext.args = '' publishDir = [ path: { "${params.outdir}/Kmerfinder/${meta.id}" }, diff --git a/workflows/bacass.nf b/workflows/bacass.nf index 293056cd..fed8253f 100644 --- a/workflows/bacass.nf +++ b/workflows/bacass.nf @@ -60,9 +60,6 @@ include { methodsDescriptionText } from '../subworkflows/local/ut def checkPathParamList = [ params.input, params.multiqc_config, params.kraken2db, params.dfast_config ] for (param in checkPathParamList) { if (param) { file(param, checkIfExists: true) } } -// Place config files here - - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ RUN MAIN WORKFLOW From cd1bf3e18d11aadec996265140562196fa07edc8 Mon Sep 17 00:00:00 2001 From: Daniel-VM Date: Mon, 18 Nov 2024 12:46:04 +0100 Subject: [PATCH 70/70] fix linting in #184 --- CHANGELOG.md | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index df87f3cb..7594ac2f 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -35,10 +35,10 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Dependencies` -| Tool | Previous version | New version | -| ---------- | ---------------- | ----------- | -| Dfast | 1.2.20 | 1.3.2 | -| Unicycler | 0.4.8 | 0.5.0 | +| Tool | Previous version | New version | +| --------- | ---------------- | ----------- | +| Dfast | 1.2.20 | 1.3.2 | +| Unicycler | 0.4.8 | 0.5.0 | ### `Deprecated`