You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
Hi all, I've seen a previous issue resolved with the same error, however I still get this error. I have aligned FASTQ files to the CHM13 genome (chm13v2.0.fa) using STAR.
head /Users/ehresms/computational/genomes/human/CHM13/fasta/chm13v2.0.fa
chr1 CP068277.2 Homo sapiens isolate CHM13 chromosome 1
Caccctaaaccctaacccctaaccctaaccctaaccctaaccctaaccctaacccctaaaccctaaccctaaccctaacc
ctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccct
aaccctaaccctaacccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacccta
accctaaccctaaccctaaccctaaccctaaccctaaccctaacccaaccctaaccctaaccctaaccctaaccctaacc
ctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccct
aaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaa
ccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacc
ctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccct
aaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaa >
I am using the chromosome lengths computed in the STAR index.
I have used the same FASTA file as I used to generate the STAR index, I have tried regenerating the FASTA from the actual index directory, I have also tried to modify the header of the BAM file to remove the "chr", in which case I get the error:
warning: invalid contig chr1
Traceback (most recent call last):
File "/Users/ehresms/opt/anaconda3/bin/rgt-THOR", line 8, in
sys.exit(main())
File "/Users/ehresms/opt/anaconda3/lib/python3.9/site-packages/rgt/THOR/THOR.py", line 155, in main
m, exp_data, func_para, init_mu, init_alpha, distr = train_HMM(region_giver, options, bamfiles, genome,
File "/Users/ehresms/opt/anaconda3/lib/python3.9/site-packages/rgt/THOR/THOR.py", line 63, in train_HMM
exp_data = initialize(name=options.name, dims=dims, genome_path=genome, regions=train_regions,
File "/Users/ehresms/opt/anaconda3/lib/python3.9/site-packages/rgt/THOR/dpc_help.py", line 427, in initialize
regionset.sequences.sort()
AttributeError: 'NoneType' object has no attribute 'sequences' >
I am also running into the same issue when I align to another genome. I tried using hg38 with setupGenomicData.py:
Hi all, I've seen a previous issue resolved with the same error, however I still get this error. I have aligned FASTQ files to the CHM13 genome (chm13v2.0.fa) using STAR.
I am using the chromosome lengths computed in the STAR index.
Here's the top of the header of one of my BAM files:
I have used the same FASTA file as I used to generate the STAR index, I have tried regenerating the FASTA from the actual index directory, I have also tried to modify the header of the BAM file to remove the "chr", in which case I get the error:
I am also running into the same issue when I align to another genome. I tried using hg38 with setupGenomicData.py:
And I've using the chromosome lengths from the STAR index for hg38.
Is there something I'm missing?
Thanks in advance for your help!
The text was updated successfully, but these errors were encountered: